Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640366_at:

>probe:Drosophila_2:1640366_at:605:289; Interrogation_Position=1661; Antisense; CGGATCTCTTTCAATGTCTCTACAA
>probe:Drosophila_2:1640366_at:53:153; Interrogation_Position=1746; Antisense; ACATGTGTCCCGCTTGGTTACGCTA
>probe:Drosophila_2:1640366_at:324:475; Interrogation_Position=1762; Antisense; GTTACGCTATTTGCCGATGTTGAAA
>probe:Drosophila_2:1640366_at:601:587; Interrogation_Position=1793; Antisense; TGGAGCTGCTGACCGAGTTCGACAA
>probe:Drosophila_2:1640366_at:503:457; Interrogation_Position=1830; Antisense; GATAGAGTCTCCCATATTTGCTCCT
>probe:Drosophila_2:1640366_at:432:721; Interrogation_Position=1855; Antisense; TTGCGTCTTACGCTTGTTTCCAAAG
>probe:Drosophila_2:1640366_at:251:331; Interrogation_Position=1891; Antisense; GCGGATGCTCAGTACTTGGCTCATG
>probe:Drosophila_2:1640366_at:690:601; Interrogation_Position=1919; Antisense; TGTTTGGCATCCTAATGCTGCTACC
>probe:Drosophila_2:1640366_at:164:203; Interrogation_Position=1952; Antisense; AAGCCTTTGACACGCTTCGGAATCG
>probe:Drosophila_2:1640366_at:179:565; Interrogation_Position=1970; Antisense; GGAATCGTTTGCAATGCGTGCCCAA
>probe:Drosophila_2:1640366_at:79:163; Interrogation_Position=2083; Antisense; AAATTGCAGAAAGCCCATCGCGAGC
>probe:Drosophila_2:1640366_at:666:325; Interrogation_Position=2102; Antisense; GCGAGCAGCGTATTGTGCACCGGAA
>probe:Drosophila_2:1640366_at:280:279; Interrogation_Position=2154; Antisense; CTAGCCTTCTTTTATGCATACCTTA
>probe:Drosophila_2:1640366_at:30:463; Interrogation_Position=2193; Antisense; GATTCAGTGTGCAGTCCTTTCATTC

Paste this into a BLAST search page for me
CGGATCTCTTTCAATGTCTCTACAAACATGTGTCCCGCTTGGTTACGCTAGTTACGCTATTTGCCGATGTTGAAATGGAGCTGCTGACCGAGTTCGACAAGATAGAGTCTCCCATATTTGCTCCTTTGCGTCTTACGCTTGTTTCCAAAGGCGGATGCTCAGTACTTGGCTCATGTGTTTGGCATCCTAATGCTGCTACCAAGCCTTTGACACGCTTCGGAATCGGGAATCGTTTGCAATGCGTGCCCAAAAATTGCAGAAAGCCCATCGCGAGCGCGAGCAGCGTATTGTGCACCGGAACTAGCCTTCTTTTATGCATACCTTAGATTCAGTGTGCAGTCCTTTCATTC

Full Affymetrix probeset data:

Annotations for 1640366_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime