FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640368_at:

>probe:Drosophila_2:1640368_at:576:273; Interrogation_Position=1020; Antisense; CATTGTTCACGCTCTGTATGTCCAA
>probe:Drosophila_2:1640368_at:395:61; Interrogation_Position=1037; Antisense; ATGTCCAATCCCTGAATACTGCATT
>probe:Drosophila_2:1640368_at:365:375; Interrogation_Position=1072; Antisense; GAAGATGTCTTCACCACGGGCATTG
>probe:Drosophila_2:1640368_at:620:391; Interrogation_Position=1102; Antisense; GAAAGTCTGAACATCCGGCGGGTAA
>probe:Drosophila_2:1640368_at:203:427; Interrogation_Position=1135; Antisense; GAGATGGCTAACACCCGGACGAAAT
>probe:Drosophila_2:1640368_at:192:397; Interrogation_Position=1155; Antisense; GAAATTCGAGACGTGCCACATCCGC
>probe:Drosophila_2:1640368_at:96:661; Interrogation_Position=1209; Antisense; TAACGAGCAGTTTACCTTGTGGAAT
>probe:Drosophila_2:1640368_at:505:405; Interrogation_Position=727; Antisense; GACTCGTACAACAATCTCACTCTGA
>probe:Drosophila_2:1640368_at:349:285; Interrogation_Position=748; Antisense; CTGAAGACCATTTCTCTGCTGGAAT
>probe:Drosophila_2:1640368_at:324:229; Interrogation_Position=770; Antisense; AATGGGCTGATCTTCACTGTCCGAA
>probe:Drosophila_2:1640368_at:251:499; Interrogation_Position=788; Antisense; GTCCGAAGGCTAAGTACGTTCTCAA
>probe:Drosophila_2:1640368_at:631:139; Interrogation_Position=836; Antisense; ACGTGCCGAAGTTATTGACCCTCAT
>probe:Drosophila_2:1640368_at:303:7; Interrogation_Position=849; Antisense; ATTGACCCTCATTAGCACGCTTAAA
>probe:Drosophila_2:1640368_at:261:675; Interrogation_Position=879; Antisense; TAGAACGATCTACGGACGACGGGCC

Paste this into a BLAST search page for me
CATTGTTCACGCTCTGTATGTCCAAATGTCCAATCCCTGAATACTGCATTGAAGATGTCTTCACCACGGGCATTGGAAAGTCTGAACATCCGGCGGGTAAGAGATGGCTAACACCCGGACGAAATGAAATTCGAGACGTGCCACATCCGCTAACGAGCAGTTTACCTTGTGGAATGACTCGTACAACAATCTCACTCTGACTGAAGACCATTTCTCTGCTGGAATAATGGGCTGATCTTCACTGTCCGAAGTCCGAAGGCTAAGTACGTTCTCAAACGTGCCGAAGTTATTGACCCTCATATTGACCCTCATTAGCACGCTTAAATAGAACGATCTACGGACGACGGGCC

Full Affymetrix probeset data:

Annotations for 1640368_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720