FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640369_at:

>probe:Drosophila_2:1640369_at:62:529; Interrogation_Position=120; Antisense; GGGAGTGGGCACTGGCATCGCGAAT
>probe:Drosophila_2:1640369_at:453:51; Interrogation_Position=13; Antisense; ATGCGCGTTCTCAACACGGAGCTGC
>probe:Drosophila_2:1640369_at:712:269; Interrogation_Position=135; Antisense; CATCGCGAATGGAGCCGGTATCGGT
>probe:Drosophila_2:1640369_at:325:33; Interrogation_Position=172; Antisense; ATAATGCCCCTCGATCAGCGACTGA
>probe:Drosophila_2:1640369_at:52:455; Interrogation_Position=184; Antisense; GATCAGCGACTGAATGGAGCCACCA
>probe:Drosophila_2:1640369_at:649:369; Interrogation_Position=195; Antisense; GAATGGAGCCACCAGTATGAAACTG
>probe:Drosophila_2:1640369_at:101:485; Interrogation_Position=209; Antisense; GTATGAAACTGTTGTGGCACGTTAT
>probe:Drosophila_2:1640369_at:452:519; Interrogation_Position=222; Antisense; GTGGCACGTTATCTGGCTTTACAAG
>probe:Drosophila_2:1640369_at:327:571; Interrogation_Position=236; Antisense; GGCTTTACAAGTGGTTGGACAACTA
>probe:Drosophila_2:1640369_at:671:553; Interrogation_Position=30; Antisense; GGAGCTGCGCCTGCGCTTCAAAAAT
>probe:Drosophila_2:1640369_at:101:323; Interrogation_Position=42; Antisense; GCGCTTCAAAAATCGCAAACCGCGA
>probe:Drosophila_2:1640369_at:63:175; Interrogation_Position=58; Antisense; AAACCGCGACCCTTTAATCGCGCTG
>probe:Drosophila_2:1640369_at:357:655; Interrogation_Position=72; Antisense; TAATCGCGCTGCCAGTGCCGATGAT
>probe:Drosophila_2:1640369_at:93:315; Interrogation_Position=82; Antisense; GCCAGTGCCGATGATGCGATGGATT

Paste this into a BLAST search page for me
GGGAGTGGGCACTGGCATCGCGAATATGCGCGTTCTCAACACGGAGCTGCCATCGCGAATGGAGCCGGTATCGGTATAATGCCCCTCGATCAGCGACTGAGATCAGCGACTGAATGGAGCCACCAGAATGGAGCCACCAGTATGAAACTGGTATGAAACTGTTGTGGCACGTTATGTGGCACGTTATCTGGCTTTACAAGGGCTTTACAAGTGGTTGGACAACTAGGAGCTGCGCCTGCGCTTCAAAAATGCGCTTCAAAAATCGCAAACCGCGAAAACCGCGACCCTTTAATCGCGCTGTAATCGCGCTGCCAGTGCCGATGATGCCAGTGCCGATGATGCGATGGATT

Full Affymetrix probeset data:

Annotations for 1640369_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720