Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640372_at:

>probe:Drosophila_2:1640372_at:398:615; Interrogation_Position=455; Antisense; TGAATCTGCTGTACCTCTTGTCTGG
>probe:Drosophila_2:1640372_at:207:645; Interrogation_Position=470; Antisense; TCTTGTCTGGCAACCGGGTATCCGA
>probe:Drosophila_2:1640372_at:468:529; Interrogation_Position=485; Antisense; GGGTATCCGACTTTCACACGGAACT
>probe:Drosophila_2:1640372_at:321:49; Interrogation_Position=532; Antisense; ATCCAGCACAATCAGTTCATTCGGC
>probe:Drosophila_2:1640372_at:324:549; Interrogation_Position=585; Antisense; GGAGGGACGCTACAACAAGATCTTT
>probe:Drosophila_2:1640372_at:312:453; Interrogation_Position=603; Antisense; GATCTTTCAGGCCAAGTCGACGGTG
>probe:Drosophila_2:1640372_at:101:37; Interrogation_Position=656; Antisense; ATCTTCTGTTGGAAACGGTGCGCGA
>probe:Drosophila_2:1640372_at:671:727; Interrogation_Position=686; Antisense; TTGGTGCCTGCATCGAGAAGTCCTA
>probe:Drosophila_2:1640372_at:94:673; Interrogation_Position=709; Antisense; TACGACAAGATCTCCGCCAAGGATG
>probe:Drosophila_2:1640372_at:640:177; Interrogation_Position=799; Antisense; AAACTGGAGGCTAGCGGCGACTACA
>probe:Drosophila_2:1640372_at:561:395; Interrogation_Position=832; Antisense; GACCGTAGCGTCAAACCCAAGGAGC
>probe:Drosophila_2:1640372_at:323:303; Interrogation_Position=900; Antisense; CCGCGACCTCGAGATGATAGTTTAA
>probe:Drosophila_2:1640372_at:277:91; Interrogation_Position=918; Antisense; AGTTTAAGTCGCAAAGCAGCCGTTA
>probe:Drosophila_2:1640372_at:406:93; Interrogation_Position=971; Antisense; AGTTCTAACACGCTGGATACCACAA

Paste this into a BLAST search page for me
TGAATCTGCTGTACCTCTTGTCTGGTCTTGTCTGGCAACCGGGTATCCGAGGGTATCCGACTTTCACACGGAACTATCCAGCACAATCAGTTCATTCGGCGGAGGGACGCTACAACAAGATCTTTGATCTTTCAGGCCAAGTCGACGGTGATCTTCTGTTGGAAACGGTGCGCGATTGGTGCCTGCATCGAGAAGTCCTATACGACAAGATCTCCGCCAAGGATGAAACTGGAGGCTAGCGGCGACTACAGACCGTAGCGTCAAACCCAAGGAGCCCGCGACCTCGAGATGATAGTTTAAAGTTTAAGTCGCAAAGCAGCCGTTAAGTTCTAACACGCTGGATACCACAA

Full Affymetrix probeset data:

Annotations for 1640372_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime