FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640373_at:

>probe:Drosophila_2:1640373_at:597:19; Interrogation_Position=1016; Antisense; ATTTGCGGGAATTGTGTCGCCACGC
>probe:Drosophila_2:1640373_at:379:269; Interrogation_Position=1044; Antisense; CATGTACCGTATGCGCCAGTTTATG
>probe:Drosophila_2:1640373_at:710:65; Interrogation_Position=1174; Antisense; ATGGAAGACCTTCTCAAGTCGCTGT
>probe:Drosophila_2:1640373_at:701:327; Interrogation_Position=1194; Antisense; GCTGTCCGTCATGAAGGCGTCGAAA
>probe:Drosophila_2:1640373_at:411:71; Interrogation_Position=1223; Antisense; AGGCGCAGGGCACTTTTCTCGAAAA
>probe:Drosophila_2:1640373_at:481:111; Interrogation_Position=730; Antisense; AGCAATGATCACGAGGCAACCGCCA
>probe:Drosophila_2:1640373_at:94:567; Interrogation_Position=744; Antisense; GGCAACCGCCATGATTAAGACTCAG
>probe:Drosophila_2:1640373_at:256:673; Interrogation_Position=801; Antisense; TACCAACATTTGTGTCCTCGTTTTG
>probe:Drosophila_2:1640373_at:359:213; Interrogation_Position=845; Antisense; AAGACCTCGATAAAGCCATCCTGCG
>probe:Drosophila_2:1640373_at:3:293; Interrogation_Position=871; Antisense; CGTATGCCCGCACAATTTCACATTG
>probe:Drosophila_2:1640373_at:42:699; Interrogation_Position=886; Antisense; TTTCACATTGGAGTGCCGCGAGACT
>probe:Drosophila_2:1640373_at:206:395; Interrogation_Position=922; Antisense; GAAATCCTTCAGTTGATCCTCCAGA
>probe:Drosophila_2:1640373_at:417:101; Interrogation_Position=948; Antisense; AGAGCAACTGAGTCCTTCGGTTAAT
>probe:Drosophila_2:1640373_at:192:581; Interrogation_Position=983; Antisense; TGGCCCGACTGACGATTGGATTTTC

Paste this into a BLAST search page for me
ATTTGCGGGAATTGTGTCGCCACGCCATGTACCGTATGCGCCAGTTTATGATGGAAGACCTTCTCAAGTCGCTGTGCTGTCCGTCATGAAGGCGTCGAAAAGGCGCAGGGCACTTTTCTCGAAAAAGCAATGATCACGAGGCAACCGCCAGGCAACCGCCATGATTAAGACTCAGTACCAACATTTGTGTCCTCGTTTTGAAGACCTCGATAAAGCCATCCTGCGCGTATGCCCGCACAATTTCACATTGTTTCACATTGGAGTGCCGCGAGACTGAAATCCTTCAGTTGATCCTCCAGAAGAGCAACTGAGTCCTTCGGTTAATTGGCCCGACTGACGATTGGATTTTC

Full Affymetrix probeset data:

Annotations for 1640373_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720