FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640374_at:

>probe:Drosophila_2:1640374_at:240:497; Interrogation_Position=1009; Antisense; GTCAGGATATTTTTAAGCCAGCGAA
>probe:Drosophila_2:1640374_at:668:701; Interrogation_Position=1082; Antisense; TTATTCTGGCATTCTGGACCTACTG
>probe:Drosophila_2:1640374_at:338:291; Interrogation_Position=1124; Antisense; CGTTAACTGGATCCGCCGACTTAAG
>probe:Drosophila_2:1640374_at:32:577; Interrogation_Position=1150; Antisense; GGCGCCGCAGTTTGGAGTATGCCAA
>probe:Drosophila_2:1640374_at:128:649; Interrogation_Position=1240; Antisense; TCAGTATGTTCTGGGTCTTTCGGGC
>probe:Drosophila_2:1640374_at:269:381; Interrogation_Position=1286; Antisense; GAACCCGGCGGCAATGGCGTATATT
>probe:Drosophila_2:1640374_at:521:405; Interrogation_Position=739; Antisense; GACTGGCCGGCGAGTTAGCTGCACT
>probe:Drosophila_2:1640374_at:530:675; Interrogation_Position=754; Antisense; TAGCTGCACTTGTCTATGGCGGAAA
>probe:Drosophila_2:1640374_at:646:329; Interrogation_Position=772; Antisense; GCGGAAAGTGGTTACGCGCCTTGAT
>probe:Drosophila_2:1640374_at:238:93; Interrogation_Position=809; Antisense; AGTTCAGGATGAGATCTCCGCCAGT
>probe:Drosophila_2:1640374_at:146:509; Interrogation_Position=832; Antisense; GTGCGGGCGGAGTCTTCATCTACAA
>probe:Drosophila_2:1640374_at:294:583; Interrogation_Position=871; Antisense; TTCACGTGGACGAGGTCTACCGGTA
>probe:Drosophila_2:1640374_at:523:417; Interrogation_Position=914; Antisense; GAGCGACTTTATGCGATCCAATGTG
>probe:Drosophila_2:1640374_at:712:249; Interrogation_Position=959; Antisense; CAATATGCCCGTGTGGATGGAACAA

Paste this into a BLAST search page for me
GTCAGGATATTTTTAAGCCAGCGAATTATTCTGGCATTCTGGACCTACTGCGTTAACTGGATCCGCCGACTTAAGGGCGCCGCAGTTTGGAGTATGCCAATCAGTATGTTCTGGGTCTTTCGGGCGAACCCGGCGGCAATGGCGTATATTGACTGGCCGGCGAGTTAGCTGCACTTAGCTGCACTTGTCTATGGCGGAAAGCGGAAAGTGGTTACGCGCCTTGATAGTTCAGGATGAGATCTCCGCCAGTGTGCGGGCGGAGTCTTCATCTACAATTCACGTGGACGAGGTCTACCGGTAGAGCGACTTTATGCGATCCAATGTGCAATATGCCCGTGTGGATGGAACAA

Full Affymetrix probeset data:

Annotations for 1640374_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720