FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640375_at:

>probe:Drosophila_2:1640375_at:200:51; Interrogation_Position=401; Antisense; ATGCCCAGGATTTCGGCTCAATGGA
>probe:Drosophila_2:1640375_at:650:183; Interrogation_Position=439; Antisense; AAAATGACTGCAGTTATCCGCCGCT
>probe:Drosophila_2:1640375_at:436:67; Interrogation_Position=475; Antisense; ATGGACAAGCATCCGCGCGACAAGA
>probe:Drosophila_2:1640375_at:135:81; Interrogation_Position=506; Antisense; AGGTGCGTCTCAAGGAGCTCATCGA
>probe:Drosophila_2:1640375_at:486:543; Interrogation_Position=567; Antisense; GGATTATCCCCGCTTCGAGTGGATT
>probe:Drosophila_2:1640375_at:708:175; Interrogation_Position=598; Antisense; AAACTCGACCTGGTGTACAAGCCAC
>probe:Drosophila_2:1640375_at:586:361; Interrogation_Position=655; Antisense; GAATCCCTCCAAAAGTTGACCGACA
>probe:Drosophila_2:1640375_at:245:211; Interrogation_Position=701; Antisense; AAGAGCGGCTAGAGGCTTACCATAA
>probe:Drosophila_2:1640375_at:703:163; Interrogation_Position=743; Antisense; AAATACCCTTCCTTGAGGAGGCCAT
>probe:Drosophila_2:1640375_at:183:559; Interrogation_Position=792; Antisense; GGAACAGATTTCCTGCGATGTCCCC
>probe:Drosophila_2:1640375_at:100:63; Interrogation_Position=809; Antisense; ATGTCCCCGTGACCGTGACAGAAGA
>probe:Drosophila_2:1640375_at:686:567; Interrogation_Position=891; Antisense; GGCAGCCGCCAGCAGCAAGAAACAA
>probe:Drosophila_2:1640375_at:421:435; Interrogation_Position=919; Antisense; GAGGATGGCTTCAATTAGGCCCGAT
>probe:Drosophila_2:1640375_at:431:671; Interrogation_Position=933; Antisense; TTAGGCCCGATTCTTTAATGTTACG

Paste this into a BLAST search page for me
ATGCCCAGGATTTCGGCTCAATGGAAAAATGACTGCAGTTATCCGCCGCTATGGACAAGCATCCGCGCGACAAGAAGGTGCGTCTCAAGGAGCTCATCGAGGATTATCCCCGCTTCGAGTGGATTAAACTCGACCTGGTGTACAAGCCACGAATCCCTCCAAAAGTTGACCGACAAAGAGCGGCTAGAGGCTTACCATAAAAATACCCTTCCTTGAGGAGGCCATGGAACAGATTTCCTGCGATGTCCCCATGTCCCCGTGACCGTGACAGAAGAGGCAGCCGCCAGCAGCAAGAAACAAGAGGATGGCTTCAATTAGGCCCGATTTAGGCCCGATTCTTTAATGTTACG

Full Affymetrix probeset data:

Annotations for 1640375_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720