Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640376_a_at:

>probe:Drosophila_2:1640376_a_at:263:21; Interrogation_Position=480; Antisense; ATATTTTTTGGGTGACATAGGTCGA
>probe:Drosophila_2:1640376_a_at:503:149; Interrogation_Position=521; Antisense; ACTTGCCAACTAATCAGGACATTCT
>probe:Drosophila_2:1640376_a_at:364:655; Interrogation_Position=531; Antisense; TAATCAGGACATTCTGCGTGCTCGA
>probe:Drosophila_2:1640376_a_at:3:509; Interrogation_Position=548; Antisense; GTGCTCGAGAGCCTACATTTAATAT
>probe:Drosophila_2:1640376_a_at:315:403; Interrogation_Position=570; Antisense; TATTACCGTTTATCCTTTTGAGTTG
>probe:Drosophila_2:1640376_a_at:172:307; Interrogation_Position=583; Antisense; CCTTTTGAGTTGGATGGCTATGTAC
>probe:Drosophila_2:1640376_a_at:156:277; Interrogation_Position=600; Antisense; CTATGTACTTAGCATGGTGGATGTA
>probe:Drosophila_2:1640376_a_at:113:589; Interrogation_Position=617; Antisense; TGGATGTAGCAGGACAGCGAACTGA
>probe:Drosophila_2:1640376_a_at:443:43; Interrogation_Position=678; Antisense; ATCGATTATATTTTTGGCAGCACTG
>probe:Drosophila_2:1640376_a_at:187:725; Interrogation_Position=691; Antisense; TTGGCAGCACTGTCGGAATATGATC
>probe:Drosophila_2:1640376_a_at:309:181; Interrogation_Position=734; Antisense; AAAACGATAATCGACTGGAGGAATC
>probe:Drosophila_2:1640376_a_at:303:549; Interrogation_Position=750; Antisense; GGAGGAATCAAAGGCTCTATTTCAT
>probe:Drosophila_2:1640376_a_at:464:225; Interrogation_Position=760; Antisense; AAGGCTCTATTTCATACTATCATAA
>probe:Drosophila_2:1640376_a_at:95:343; Interrogation_Position=805; Antisense; GCTTCAATCATTCTGTTTCTTAACA

Paste this into a BLAST search page for me
ATATTTTTTGGGTGACATAGGTCGAACTTGCCAACTAATCAGGACATTCTTAATCAGGACATTCTGCGTGCTCGAGTGCTCGAGAGCCTACATTTAATATTATTACCGTTTATCCTTTTGAGTTGCCTTTTGAGTTGGATGGCTATGTACCTATGTACTTAGCATGGTGGATGTATGGATGTAGCAGGACAGCGAACTGAATCGATTATATTTTTGGCAGCACTGTTGGCAGCACTGTCGGAATATGATCAAAACGATAATCGACTGGAGGAATCGGAGGAATCAAAGGCTCTATTTCATAAGGCTCTATTTCATACTATCATAAGCTTCAATCATTCTGTTTCTTAACA

Full Affymetrix probeset data:

Annotations for 1640376_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime