FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640382_at:

>probe:Drosophila_2:1640382_at:28:183; Interrogation_Position=3945; Antisense; AAAACCACTGCCAGTAGTCGCTACA
>probe:Drosophila_2:1640382_at:726:485; Interrogation_Position=3958; Antisense; GTAGTCGCTACACTGCCGGTGGCAA
>probe:Drosophila_2:1640382_at:208:525; Interrogation_Position=3983; Antisense; GGGCATTCATCGACAGCTGACAGCT
>probe:Drosophila_2:1640382_at:689:559; Interrogation_Position=4008; Antisense; GGAAACTCGGATGCCATGTCCGTGA
>probe:Drosophila_2:1640382_at:140:61; Interrogation_Position=4023; Antisense; ATGTCCGTGAAGTCAGGCAAATCCA
>probe:Drosophila_2:1640382_at:27:547; Interrogation_Position=4118; Antisense; GGATCCATATGCGTATATACCACTC
>probe:Drosophila_2:1640382_at:68:685; Interrogation_Position=4133; Antisense; TATACCACTCACTAGGAATAACCTG
>probe:Drosophila_2:1640382_at:613:531; Interrogation_Position=4239; Antisense; GGTGGCCGGGTGTCCAAGAAATACA
>probe:Drosophila_2:1640382_at:132:569; Interrogation_Position=4269; Antisense; GGCAGACGATTCAAGCCAACTGGCT
>probe:Drosophila_2:1640382_at:708:311; Interrogation_Position=4283; Antisense; GCCAACTGGCTAACAGGCTCGTAAA
>probe:Drosophila_2:1640382_at:446:257; Interrogation_Position=4336; Antisense; CACTGGGATAGTGCGGTCTGTTGAT
>probe:Drosophila_2:1640382_at:274:409; Interrogation_Position=4372; Antisense; GACGTTGATGATTATTTCCCCTGTT
>probe:Drosophila_2:1640382_at:604:715; Interrogation_Position=4387; Antisense; TTCCCCTGTTACTTTGCTTAAATAT
>probe:Drosophila_2:1640382_at:547:551; Interrogation_Position=4446; Antisense; GGAGACGTTGTAAATGCCACAGATA

Paste this into a BLAST search page for me
AAAACCACTGCCAGTAGTCGCTACAGTAGTCGCTACACTGCCGGTGGCAAGGGCATTCATCGACAGCTGACAGCTGGAAACTCGGATGCCATGTCCGTGAATGTCCGTGAAGTCAGGCAAATCCAGGATCCATATGCGTATATACCACTCTATACCACTCACTAGGAATAACCTGGGTGGCCGGGTGTCCAAGAAATACAGGCAGACGATTCAAGCCAACTGGCTGCCAACTGGCTAACAGGCTCGTAAACACTGGGATAGTGCGGTCTGTTGATGACGTTGATGATTATTTCCCCTGTTTTCCCCTGTTACTTTGCTTAAATATGGAGACGTTGTAAATGCCACAGATA

Full Affymetrix probeset data:

Annotations for 1640382_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720