Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640383_at:

>probe:Drosophila_2:1640383_at:459:341; Interrogation_Position=1730; Antisense; GCTTTGAGGAATCCGTGCTCACATT
>probe:Drosophila_2:1640383_at:271:279; Interrogation_Position=1771; Antisense; CTACTCCCCGTCAATGTTAACATGT
>probe:Drosophila_2:1640383_at:653:187; Interrogation_Position=1789; Antisense; AACATGTACTGCGAGATCCTGCATC
>probe:Drosophila_2:1640383_at:77:47; Interrogation_Position=1804; Antisense; ATCCTGCATCGTGCGCTTTTGGAAG
>probe:Drosophila_2:1640383_at:559:215; Interrogation_Position=1849; Antisense; AAGATCTGCCGAATGGGCCAGCATT
>probe:Drosophila_2:1640383_at:110:65; Interrogation_Position=1861; Antisense; ATGGGCCAGCATTCCAGCTTGTGGG
>probe:Drosophila_2:1640383_at:550:377; Interrogation_Position=1911; Antisense; GAAGCACCAGTTGCAGATCAGCGAG
>probe:Drosophila_2:1640383_at:234:513; Interrogation_Position=1969; Antisense; GTGAGCTACCTGCAGCACCTGAAGG
>probe:Drosophila_2:1640383_at:333:387; Interrogation_Position=2026; Antisense; GAAAACTCACTAATGCTGGGCAGGA
>probe:Drosophila_2:1640383_at:134:727; Interrogation_Position=2054; Antisense; TTGAGGCAGAGACCATCCTGCTGCA
>probe:Drosophila_2:1640383_at:443:147; Interrogation_Position=2106; Antisense; ACTAGCCCTGCGGATGCACAACTGG
>probe:Drosophila_2:1640383_at:664:573; Interrogation_Position=2129; Antisense; GGCGGCGGGCCCTGGAAATATCACA
>probe:Drosophila_2:1640383_at:446:679; Interrogation_Position=2180; Antisense; TAGTGCCGCGAGTCCTCCAGGAGAG
>probe:Drosophila_2:1640383_at:689:483; Interrogation_Position=2250; Antisense; GTATCTGCCCCTGGTGGCTAAAGAA

Paste this into a BLAST search page for me
GCTTTGAGGAATCCGTGCTCACATTCTACTCCCCGTCAATGTTAACATGTAACATGTACTGCGAGATCCTGCATCATCCTGCATCGTGCGCTTTTGGAAGAAGATCTGCCGAATGGGCCAGCATTATGGGCCAGCATTCCAGCTTGTGGGGAAGCACCAGTTGCAGATCAGCGAGGTGAGCTACCTGCAGCACCTGAAGGGAAAACTCACTAATGCTGGGCAGGATTGAGGCAGAGACCATCCTGCTGCAACTAGCCCTGCGGATGCACAACTGGGGCGGCGGGCCCTGGAAATATCACATAGTGCCGCGAGTCCTCCAGGAGAGGTATCTGCCCCTGGTGGCTAAAGAA

Full Affymetrix probeset data:

Annotations for 1640383_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime