FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640386_at:

>probe:Drosophila_2:1640386_at:394:211; Interrogation_Position=383; Antisense; AAGAACTTCCCGAGTATCTTCCTGT
>probe:Drosophila_2:1640386_at:142:201; Interrogation_Position=416; Antisense; AACGCTGATGAGTACGTCCAGCTTC
>probe:Drosophila_2:1640386_at:678:673; Interrogation_Position=442; Antisense; TAGCCACGTCGACGTAACGCTGGAC
>probe:Drosophila_2:1640386_at:355:199; Interrogation_Position=457; Antisense; AACGCTGGACAATCTGAAGGCTTTT
>probe:Drosophila_2:1640386_at:264:703; Interrogation_Position=478; Antisense; TTTTGTCAGTGCCAACACACCTCTG
>probe:Drosophila_2:1640386_at:128:157; Interrogation_Position=494; Antisense; ACACCTCTGTACATCGGTCGTGATG
>probe:Drosophila_2:1640386_at:269:441; Interrogation_Position=515; Antisense; GATGGCTGCATCAAAGAGTTCAACG
>probe:Drosophila_2:1640386_at:376:211; Interrogation_Position=548; Antisense; AAGAACTATGCCAATATCCCCGATG
>probe:Drosophila_2:1640386_at:75:243; Interrogation_Position=560; Antisense; AATATCCCCGATGCAGAGCAACTGA
>probe:Drosophila_2:1640386_at:191:209; Interrogation_Position=608; Antisense; AAGCAGGAGCAGCTGACCGATCCCG
>probe:Drosophila_2:1640386_at:429:523; Interrogation_Position=651; Antisense; GGGCCTATCTGATCTACATGCGGAA
>probe:Drosophila_2:1640386_at:547:137; Interrogation_Position=681; Antisense; ACGAGGTGGGCTACGATTTCCTGGA
>probe:Drosophila_2:1640386_at:474:215; Interrogation_Position=795; Antisense; AAGTCTTCAGGGTTCACAAGGTCAC
>probe:Drosophila_2:1640386_at:560:223; Interrogation_Position=812; Antisense; AAGGTCACCAAGACAGCGCCGGAAA

Paste this into a BLAST search page for me
AAGAACTTCCCGAGTATCTTCCTGTAACGCTGATGAGTACGTCCAGCTTCTAGCCACGTCGACGTAACGCTGGACAACGCTGGACAATCTGAAGGCTTTTTTTTGTCAGTGCCAACACACCTCTGACACCTCTGTACATCGGTCGTGATGGATGGCTGCATCAAAGAGTTCAACGAAGAACTATGCCAATATCCCCGATGAATATCCCCGATGCAGAGCAACTGAAAGCAGGAGCAGCTGACCGATCCCGGGGCCTATCTGATCTACATGCGGAAACGAGGTGGGCTACGATTTCCTGGAAAGTCTTCAGGGTTCACAAGGTCACAAGGTCACCAAGACAGCGCCGGAAA

Full Affymetrix probeset data:

Annotations for 1640386_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720