FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640389_at:

>probe:Drosophila_2:1640389_at:472:569; Interrogation_Position=162; Antisense; GGCTTGTATGCGTAGGACCGAGATC
>probe:Drosophila_2:1640389_at:708:411; Interrogation_Position=177; Antisense; GACCGAGATCTCAATGTCGCAACTG
>probe:Drosophila_2:1640389_at:130:725; Interrogation_Position=19; Antisense; TTGCTTTGCCTCACTCTTAGTGAAT
>probe:Drosophila_2:1640389_at:28:391; Interrogation_Position=201; Antisense; GAAACTCTTTCACATGAGCCTGATG
>probe:Drosophila_2:1640389_at:629:417; Interrogation_Position=294; Antisense; GAGCTGTCTGTATGAGACCCTGGAT
>probe:Drosophila_2:1640389_at:719:59; Interrogation_Position=332; Antisense; ATGTCCTGCTGGAGGAGGCCTTTAA
>probe:Drosophila_2:1640389_at:687:239; Interrogation_Position=41; Antisense; AATTCGTTTCTAAAGCATGGACCCG
>probe:Drosophila_2:1640389_at:109:181; Interrogation_Position=425; Antisense; AAACACGATGCGAGGCAGCCTACAA
>probe:Drosophila_2:1640389_at:258:355; Interrogation_Position=453; Antisense; GCACCTGTGCTACAATCACCTGAAA
>probe:Drosophila_2:1640389_at:131:83; Interrogation_Position=551; Antisense; AGGGCAGCGACTTTATCGACGGCAT
>probe:Drosophila_2:1640389_at:118:295; Interrogation_Position=567; Antisense; CGACGGCATCCAGCATTCCGGAGAA
>probe:Drosophila_2:1640389_at:238:377; Interrogation_Position=589; Antisense; GAAGCAATGACCACCGCTAAGTCGG
>probe:Drosophila_2:1640389_at:670:629; Interrogation_Position=73; Antisense; TCCGTCTCGCTGAACATGTCGATGA
>probe:Drosophila_2:1640389_at:341:61; Interrogation_Position=88; Antisense; ATGTCGATGACACGAACCCTGGTTC

Paste this into a BLAST search page for me
GGCTTGTATGCGTAGGACCGAGATCGACCGAGATCTCAATGTCGCAACTGTTGCTTTGCCTCACTCTTAGTGAATGAAACTCTTTCACATGAGCCTGATGGAGCTGTCTGTATGAGACCCTGGATATGTCCTGCTGGAGGAGGCCTTTAAAATTCGTTTCTAAAGCATGGACCCGAAACACGATGCGAGGCAGCCTACAAGCACCTGTGCTACAATCACCTGAAAAGGGCAGCGACTTTATCGACGGCATCGACGGCATCCAGCATTCCGGAGAAGAAGCAATGACCACCGCTAAGTCGGTCCGTCTCGCTGAACATGTCGATGAATGTCGATGACACGAACCCTGGTTC

Full Affymetrix probeset data:

Annotations for 1640389_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720