FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640390_at:

>probe:Drosophila_2:1640390_at:505:475; Interrogation_Position=1044; Antisense; GTTTTGTCTGATTGCAGCCACAGCT
>probe:Drosophila_2:1640390_at:730:707; Interrogation_Position=1100; Antisense; TTAACCACGTGGACTTGTCGCCAAA
>probe:Drosophila_2:1640390_at:531:191; Interrogation_Position=1123; Antisense; AACTTTGCTGGACTCCTGTTTGGGA
>probe:Drosophila_2:1640390_at:152:187; Interrogation_Position=1153; Antisense; AACACACTGATGTCTGCGGCTGGTG
>probe:Drosophila_2:1640390_at:665:285; Interrogation_Position=1172; Antisense; CTGGTGTGATATCGCCAATCGTCAT
>probe:Drosophila_2:1640390_at:364:227; Interrogation_Position=1232; Antisense; AATGGCGAACAGTTTTCCTTGGCAT
>probe:Drosophila_2:1640390_at:506:629; Interrogation_Position=1247; Antisense; TCCTTGGCATTTCGGTGATTCTGTT
>probe:Drosophila_2:1640390_at:661:469; Interrogation_Position=1269; Antisense; GTTCCTCGGCAACTTGATGTACCTA
>probe:Drosophila_2:1640390_at:28:495; Interrogation_Position=1301; Antisense; GTCAAATGACCGTCCAGTCCTGGAA
>probe:Drosophila_2:1640390_at:485:603; Interrogation_Position=1326; Antisense; TGATTCCCCATCCAAAGAGACCGAA
>probe:Drosophila_2:1640390_at:508:593; Interrogation_Position=867; Antisense; TGTGGTCATGCTGATGTCATCCTAC
>probe:Drosophila_2:1640390_at:530:279; Interrogation_Position=888; Antisense; CTACGGATTCATTTTCCTGGCTGAA
>probe:Drosophila_2:1640390_at:78:637; Interrogation_Position=927; Antisense; TCGAGACATTTCATTGCCTATCCTA
>probe:Drosophila_2:1640390_at:206:591; Interrogation_Position=998; Antisense; TGGTTATCCTATCCTACGTCAGCGA

Paste this into a BLAST search page for me
GTTTTGTCTGATTGCAGCCACAGCTTTAACCACGTGGACTTGTCGCCAAAAACTTTGCTGGACTCCTGTTTGGGAAACACACTGATGTCTGCGGCTGGTGCTGGTGTGATATCGCCAATCGTCATAATGGCGAACAGTTTTCCTTGGCATTCCTTGGCATTTCGGTGATTCTGTTGTTCCTCGGCAACTTGATGTACCTAGTCAAATGACCGTCCAGTCCTGGAATGATTCCCCATCCAAAGAGACCGAATGTGGTCATGCTGATGTCATCCTACCTACGGATTCATTTTCCTGGCTGAATCGAGACATTTCATTGCCTATCCTATGGTTATCCTATCCTACGTCAGCGA

Full Affymetrix probeset data:

Annotations for 1640390_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720