Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640391_at:

>probe:Drosophila_2:1640391_at:207:707; Interrogation_Position=4213; Antisense; TTAGACCTCTGTTAGCCGGATGCGA
>probe:Drosophila_2:1640391_at:730:625; Interrogation_Position=4270; Antisense; TGCCGTGACAGAGTAGCTGCCCCAG
>probe:Drosophila_2:1640391_at:371:675; Interrogation_Position=4283; Antisense; TAGCTGCCCCAGAAGACATGACAAA
>probe:Drosophila_2:1640391_at:428:205; Interrogation_Position=4349; Antisense; AAGCCCTTCCTTCAGGTCGTGAGTG
>probe:Drosophila_2:1640391_at:410:375; Interrogation_Position=4373; Antisense; GAAGATCGTGTGTTTGTACTTTTAT
>probe:Drosophila_2:1640391_at:670:697; Interrogation_Position=4435; Antisense; TTTTTTATTAGCTCACTTGCTCCCG
>probe:Drosophila_2:1640391_at:573:617; Interrogation_Position=4452; Antisense; TGCTCCCGCCCCTAACTAAATAATT
>probe:Drosophila_2:1640391_at:675:11; Interrogation_Position=4474; Antisense; ATTAGCTAACTCCAAGAACGCCAAG
>probe:Drosophila_2:1640391_at:430:211; Interrogation_Position=4487; Antisense; AAGAACGCCAAGTATTCGCCCACTC
>probe:Drosophila_2:1640391_at:583:633; Interrogation_Position=4510; Antisense; TCCCTGCGAGAAAACCACATGAGTA
>probe:Drosophila_2:1640391_at:113:419; Interrogation_Position=4626; Antisense; GAGCTGAGAGGATTACTCCCCTGTG
>probe:Drosophila_2:1640391_at:237:633; Interrogation_Position=4642; Antisense; TCCCCTGTGCTAGTCCTTTTAAAAT
>probe:Drosophila_2:1640391_at:324:473; Interrogation_Position=4667; Antisense; GTTAACCTACTTAAAGCTAGCCTGT
>probe:Drosophila_2:1640391_at:185:249; Interrogation_Position=4718; Antisense; AATTGTACAAATGCCCACGTATTTA

Paste this into a BLAST search page for me
TTAGACCTCTGTTAGCCGGATGCGATGCCGTGACAGAGTAGCTGCCCCAGTAGCTGCCCCAGAAGACATGACAAAAAGCCCTTCCTTCAGGTCGTGAGTGGAAGATCGTGTGTTTGTACTTTTATTTTTTTATTAGCTCACTTGCTCCCGTGCTCCCGCCCCTAACTAAATAATTATTAGCTAACTCCAAGAACGCCAAGAAGAACGCCAAGTATTCGCCCACTCTCCCTGCGAGAAAACCACATGAGTAGAGCTGAGAGGATTACTCCCCTGTGTCCCCTGTGCTAGTCCTTTTAAAATGTTAACCTACTTAAAGCTAGCCTGTAATTGTACAAATGCCCACGTATTTA

Full Affymetrix probeset data:

Annotations for 1640391_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime