FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640392_at:

>probe:Drosophila_2:1640392_at:630:721; Interrogation_Position=235; Antisense; TTGCTCTTTTGCTCCATACTGATGG
>probe:Drosophila_2:1640392_at:403:29; Interrogation_Position=250; Antisense; ATACTGATGGTGCTATCGTCGGTTC
>probe:Drosophila_2:1640392_at:84:683; Interrogation_Position=263; Antisense; TATCGTCGGTTCTGCTCATATTGGG
>probe:Drosophila_2:1640392_at:695:645; Interrogation_Position=278; Antisense; TCATATTGGGCCTCCAGCAGAACAA
>probe:Drosophila_2:1640392_at:575:99; Interrogation_Position=302; Antisense; AGAGACATCTGCTGATACCCTGGAT
>probe:Drosophila_2:1640392_at:14:543; Interrogation_Position=323; Antisense; GGATTAGTTTCATGCTGGGCGATCT
>probe:Drosophila_2:1640392_at:518:619; Interrogation_Position=347; Antisense; TGCTCATCGAGGTCTGCCACTTGGT
>probe:Drosophila_2:1640392_at:579:319; Interrogation_Position=389; Antisense; GCCGCGTCAAGTTCGATCCGATTGT
>probe:Drosophila_2:1640392_at:337:501; Interrogation_Position=411; Antisense; TGTCGGTTTCATCTTTACCATGGAT
>probe:Drosophila_2:1640392_at:50:673; Interrogation_Position=426; Antisense; TACCATGGATTTCTTCCTACTGTGC
>probe:Drosophila_2:1640392_at:250:239; Interrogation_Position=454; Antisense; AATCTTTACTGTCTGCTGTGCGTCA
>probe:Drosophila_2:1640392_at:659:569; Interrogation_Position=537; Antisense; GGCATCGCCTATTGTGGTCTTCACA
>probe:Drosophila_2:1640392_at:432:253; Interrogation_Position=645; Antisense; CAAGCGGCGACGTATGCTCGGAGCA
>probe:Drosophila_2:1640392_at:396:25; Interrogation_Position=790; Antisense; ATACCAATTTTCACTCTGGCTTCCA

Paste this into a BLAST search page for me
TTGCTCTTTTGCTCCATACTGATGGATACTGATGGTGCTATCGTCGGTTCTATCGTCGGTTCTGCTCATATTGGGTCATATTGGGCCTCCAGCAGAACAAAGAGACATCTGCTGATACCCTGGATGGATTAGTTTCATGCTGGGCGATCTTGCTCATCGAGGTCTGCCACTTGGTGCCGCGTCAAGTTCGATCCGATTGTTGTCGGTTTCATCTTTACCATGGATTACCATGGATTTCTTCCTACTGTGCAATCTTTACTGTCTGCTGTGCGTCAGGCATCGCCTATTGTGGTCTTCACACAAGCGGCGACGTATGCTCGGAGCAATACCAATTTTCACTCTGGCTTCCA

Full Affymetrix probeset data:

Annotations for 1640392_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720