Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640393_s_at:

>probe:Drosophila_2:1640393_s_at:520:177; Interrogation_Position=1007; Antisense; AAACGGCTGCCACATAGATCCTAAT
>probe:Drosophila_2:1640393_s_at:672:187; Interrogation_Position=1050; Antisense; AACAGCCGACTCGTGCAAGTTTGGA
>probe:Drosophila_2:1640393_s_at:65:589; Interrogation_Position=1071; Antisense; TGGAGTTCGCAATGAACGGCCCACA
>probe:Drosophila_2:1640393_s_at:634:613; Interrogation_Position=1083; Antisense; TGAACGGCCCACAGATTAATATAGT
>probe:Drosophila_2:1640393_s_at:149:13; Interrogation_Position=1193; Antisense; ATTCATTTTCTTATCGGGCATTTTG
>probe:Drosophila_2:1640393_s_at:154:569; Interrogation_Position=1209; Antisense; GGCATTTTGGCGAAAGGACGATTTA
>probe:Drosophila_2:1640393_s_at:25:243; Interrogation_Position=733; Antisense; AATTAGAGCGCTGCTGACCTTACTC
>probe:Drosophila_2:1640393_s_at:590:411; Interrogation_Position=748; Antisense; GACCTTACTCTTACTGGCATTGCGT
>probe:Drosophila_2:1640393_s_at:687:507; Interrogation_Position=771; Antisense; GTGCGAGGCTGTTGCTTTCAAGTGA
>probe:Drosophila_2:1640393_s_at:358:83; Interrogation_Position=791; Antisense; AGTGATTCGATGACTGTTTCCTGCC
>probe:Drosophila_2:1640393_s_at:102:261; Interrogation_Position=811; Antisense; CTGCCTGGAACACCGCGTTCAAGGG
>probe:Drosophila_2:1640393_s_at:469:549; Interrogation_Position=835; Antisense; GGAGTTACATCCACAATTACCATAT
>probe:Drosophila_2:1640393_s_at:620:427; Interrogation_Position=916; Antisense; GAGATTTGTCACTAGTTTGACCGCA
>probe:Drosophila_2:1640393_s_at:270:9; Interrogation_Position=973; Antisense; ATACCTTGGCGGTTTGAAAGTGTCT

Paste this into a BLAST search page for me
AAACGGCTGCCACATAGATCCTAATAACAGCCGACTCGTGCAAGTTTGGATGGAGTTCGCAATGAACGGCCCACATGAACGGCCCACAGATTAATATAGTATTCATTTTCTTATCGGGCATTTTGGGCATTTTGGCGAAAGGACGATTTAAATTAGAGCGCTGCTGACCTTACTCGACCTTACTCTTACTGGCATTGCGTGTGCGAGGCTGTTGCTTTCAAGTGAAGTGATTCGATGACTGTTTCCTGCCCTGCCTGGAACACCGCGTTCAAGGGGGAGTTACATCCACAATTACCATATGAGATTTGTCACTAGTTTGACCGCAATACCTTGGCGGTTTGAAAGTGTCT

Full Affymetrix probeset data:

Annotations for 1640393_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime