Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640394_s_at:

>probe:Drosophila_2:1640394_s_at:388:287; Interrogation_Position=1023; Antisense; CGGCTCGTCTGATCGTGTCCAATAG
>probe:Drosophila_2:1640394_s_at:316:505; Interrogation_Position=1039; Antisense; GTCCAATAGCCCCAGATCTAGCAAA
>probe:Drosophila_2:1640394_s_at:305:683; Interrogation_Position=563; Antisense; TATGCGGGCGTACACACACGAAGTC
>probe:Drosophila_2:1640394_s_at:713:537; Interrogation_Position=598; Antisense; GGTACCGAGCTCCAGAGATTCTGTT
>probe:Drosophila_2:1640394_s_at:646:133; Interrogation_Position=627; Antisense; ACGAAATTCTACTCCACGGGCGTGG
>probe:Drosophila_2:1640394_s_at:336:431; Interrogation_Position=659; Antisense; GAGTCTAGGCTGCATTTTCTCTGAA
>probe:Drosophila_2:1640394_s_at:29:643; Interrogation_Position=678; Antisense; TCTGAAATGATTATGCGCCGCTCCT
>probe:Drosophila_2:1640394_s_at:282:461; Interrogation_Position=740; Antisense; GATTTTCCGTACCTTAAGCACACCT
>probe:Drosophila_2:1640394_s_at:558:161; Interrogation_Position=773; Antisense; AAATTGGCCTGGTGTGACGCAGCTG
>probe:Drosophila_2:1640394_s_at:668:297; Interrogation_Position=790; Antisense; CGCAGCTGCCAGACTTTAAGACCAA
>probe:Drosophila_2:1640394_s_at:291:71; Interrogation_Position=865; Antisense; AGGCGCACGAACTCATAATGTCAAT
>probe:Drosophila_2:1640394_s_at:64:495; Interrogation_Position=884; Antisense; GTCAATGCTGTGCTATGATCCCAAC
>probe:Drosophila_2:1640394_s_at:359:343; Interrogation_Position=942; Antisense; GCTTACTTCCGCAATGTGCAGCATG
>probe:Drosophila_2:1640394_s_at:266:59; Interrogation_Position=964; Antisense; ATGTTGACCATGTAGCCCTGCCTGT

Paste this into a BLAST search page for me
CGGCTCGTCTGATCGTGTCCAATAGGTCCAATAGCCCCAGATCTAGCAAATATGCGGGCGTACACACACGAAGTCGGTACCGAGCTCCAGAGATTCTGTTACGAAATTCTACTCCACGGGCGTGGGAGTCTAGGCTGCATTTTCTCTGAATCTGAAATGATTATGCGCCGCTCCTGATTTTCCGTACCTTAAGCACACCTAAATTGGCCTGGTGTGACGCAGCTGCGCAGCTGCCAGACTTTAAGACCAAAGGCGCACGAACTCATAATGTCAATGTCAATGCTGTGCTATGATCCCAACGCTTACTTCCGCAATGTGCAGCATGATGTTGACCATGTAGCCCTGCCTGT

Full Affymetrix probeset data:

Annotations for 1640394_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime