Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640399_at:

>probe:Drosophila_2:1640399_at:479:343; Interrogation_Position=1950; Antisense; GAATCCCGTTAACAAGTGTCACATT
>probe:Drosophila_2:1640399_at:457:729; Interrogation_Position=1974; Antisense; TTGGTGATTGCAACGACTGTCTCAT
>probe:Drosophila_2:1640399_at:154:199; Interrogation_Position=1985; Antisense; AACGACTGTCTCATACGGCATTTAT
>probe:Drosophila_2:1640399_at:505:375; Interrogation_Position=2134; Antisense; GAAGAGGCTGGCTAACGTTCTGCAG
>probe:Drosophila_2:1640399_at:307:641; Interrogation_Position=2152; Antisense; TCTGCAGCTCTCTTACCAAATTCTA
>probe:Drosophila_2:1640399_at:60:311; Interrogation_Position=2167; Antisense; CCAAATTCTATAGCCGCAGGTCAAT
>probe:Drosophila_2:1640399_at:420:599; Interrogation_Position=2219; Antisense; TGTCTGATTTTTGGCTTCATCGACT
>probe:Drosophila_2:1640399_at:162:713; Interrogation_Position=2234; Antisense; TTCATCGACTTTTCGGCCAACGTTT
>probe:Drosophila_2:1640399_at:521:509; Interrogation_Position=2296; Antisense; GTGAAATTGCAGTTTGGCCACAAAC
>probe:Drosophila_2:1640399_at:576:53; Interrogation_Position=2328; Antisense; ATGCAACACGCGTAGCAGAGTTTGT
>probe:Drosophila_2:1640399_at:716:513; Interrogation_Position=2361; Antisense; GTGTTTGTAAAATGCCACGCCTACA
>probe:Drosophila_2:1640399_at:299:601; Interrogation_Position=2391; Antisense; TGTACCGCCCACTTGGAAAGTCATA
>probe:Drosophila_2:1640399_at:700:365; Interrogation_Position=2424; Antisense; GAATCATCCCAACCATATGCAACGA
>probe:Drosophila_2:1640399_at:624:349; Interrogation_Position=2482; Antisense; GCAGGTGGTCAAATATTTGCCATTA

Paste this into a BLAST search page for me
GAATCCCGTTAACAAGTGTCACATTTTGGTGATTGCAACGACTGTCTCATAACGACTGTCTCATACGGCATTTATGAAGAGGCTGGCTAACGTTCTGCAGTCTGCAGCTCTCTTACCAAATTCTACCAAATTCTATAGCCGCAGGTCAATTGTCTGATTTTTGGCTTCATCGACTTTCATCGACTTTTCGGCCAACGTTTGTGAAATTGCAGTTTGGCCACAAACATGCAACACGCGTAGCAGAGTTTGTGTGTTTGTAAAATGCCACGCCTACATGTACCGCCCACTTGGAAAGTCATAGAATCATCCCAACCATATGCAACGAGCAGGTGGTCAAATATTTGCCATTA

Full Affymetrix probeset data:

Annotations for 1640399_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime