FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640400_at:

>probe:Drosophila_2:1640400_at:39:201; Interrogation_Position=179; Antisense; AACGCGTGGCAGTCGTCGCATTTGC
>probe:Drosophila_2:1640400_at:405:273; Interrogation_Position=197; Antisense; CATTTGCTGTTTTGCTCGCCGGATT
>probe:Drosophila_2:1640400_at:244:465; Interrogation_Position=218; Antisense; GATTGTGCGTGCTATCCGGTCTGAA
>probe:Drosophila_2:1640400_at:381:233; Interrogation_Position=241; Antisense; AATGCGGCACCCGTGGAATGCAATA
>probe:Drosophila_2:1640400_at:303:533; Interrogation_Position=271; Antisense; GGTGGCATCCAGATCTCTGACGATG
>probe:Drosophila_2:1640400_at:212:441; Interrogation_Position=292; Antisense; GATGGTTTCCAGAGCCAGACGCAAA
>probe:Drosophila_2:1640400_at:278:263; Interrogation_Position=337; Antisense; CAGACCTCCGAGGATGGAACCCAGA
>probe:Drosophila_2:1640400_at:163:89; Interrogation_Position=373; Antisense; AGTCAGTCGGGCAATGGCTACCAAT
>probe:Drosophila_2:1640400_at:431:67; Interrogation_Position=386; Antisense; ATGGCTACCAATCGCAGACGCAGTG
>probe:Drosophila_2:1640400_at:647:571; Interrogation_Position=415; Antisense; GGCTCATCCTGTGGTCAGTTCAACA
>probe:Drosophila_2:1640400_at:275:341; Interrogation_Position=450; Antisense; GCTATTCACCATTAAGCCGCTGGAG
>probe:Drosophila_2:1640400_at:505:553; Interrogation_Position=471; Antisense; GGAGCCATTGGCACCCATCACTTGG
>probe:Drosophila_2:1640400_at:289:353; Interrogation_Position=531; Antisense; GCAGCAGGTCAATTTTGGCTAAGTT
>probe:Drosophila_2:1640400_at:685:325; Interrogation_Position=689; Antisense; GCGACTTAACGGTCTATCACCATAA

Paste this into a BLAST search page for me
AACGCGTGGCAGTCGTCGCATTTGCCATTTGCTGTTTTGCTCGCCGGATTGATTGTGCGTGCTATCCGGTCTGAAAATGCGGCACCCGTGGAATGCAATAGGTGGCATCCAGATCTCTGACGATGGATGGTTTCCAGAGCCAGACGCAAACAGACCTCCGAGGATGGAACCCAGAAGTCAGTCGGGCAATGGCTACCAATATGGCTACCAATCGCAGACGCAGTGGGCTCATCCTGTGGTCAGTTCAACAGCTATTCACCATTAAGCCGCTGGAGGGAGCCATTGGCACCCATCACTTGGGCAGCAGGTCAATTTTGGCTAAGTTGCGACTTAACGGTCTATCACCATAA

Full Affymetrix probeset data:

Annotations for 1640400_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720