FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640401_at:

>probe:Drosophila_2:1640401_at:601:7; Interrogation_Position=1001; Antisense; ATTCGGATTTAGTTCACCTAGTCAA
>probe:Drosophila_2:1640401_at:6:3; Interrogation_Position=1049; Antisense; ATTTGGTCCTTTAGGTCGCGGATTG
>probe:Drosophila_2:1640401_at:562:683; Interrogation_Position=1082; Antisense; TATCACCTTGGATGTTGGCGGCACA
>probe:Drosophila_2:1640401_at:142:679; Interrogation_Position=1129; Antisense; TAGGACAACTTTTGCATCCTTTCCT
>probe:Drosophila_2:1640401_at:258:47; Interrogation_Position=1144; Antisense; ATCCTTTCCTCGGATTTCTGGGATA
>probe:Drosophila_2:1640401_at:678:357; Interrogation_Position=1201; Antisense; GAACCTGGTTGCTTAACGCTTAGTT
>probe:Drosophila_2:1640401_at:383:189; Interrogation_Position=1269; Antisense; AACATTTGTCCAGGCCAAGCTTTGT
>probe:Drosophila_2:1640401_at:99:543; Interrogation_Position=742; Antisense; GGATACTAGGTGGTCCTCGGCCGAA
>probe:Drosophila_2:1640401_at:584:587; Interrogation_Position=791; Antisense; TGGTATCCTTCCTGGTCATTTAGAC
>probe:Drosophila_2:1640401_at:288:675; Interrogation_Position=811; Antisense; TAGACGGTTCGGTAGTTCCAAATAG
>probe:Drosophila_2:1640401_at:287:517; Interrogation_Position=835; Antisense; GTGTGCTAAATGTTGCTGGCGGAAT
>probe:Drosophila_2:1640401_at:486:397; Interrogation_Position=898; Antisense; GACAACATGGACTTTTCGGAACTGG
>probe:Drosophila_2:1640401_at:535:287; Interrogation_Position=919; Antisense; CTGGATTTCTTAGTGGACCTTCGTT
>probe:Drosophila_2:1640401_at:173:571; Interrogation_Position=953; Antisense; TGGCATTTTTACTCCAATCGGAAAT

Paste this into a BLAST search page for me
ATTCGGATTTAGTTCACCTAGTCAAATTTGGTCCTTTAGGTCGCGGATTGTATCACCTTGGATGTTGGCGGCACATAGGACAACTTTTGCATCCTTTCCTATCCTTTCCTCGGATTTCTGGGATAGAACCTGGTTGCTTAACGCTTAGTTAACATTTGTCCAGGCCAAGCTTTGTGGATACTAGGTGGTCCTCGGCCGAATGGTATCCTTCCTGGTCATTTAGACTAGACGGTTCGGTAGTTCCAAATAGGTGTGCTAAATGTTGCTGGCGGAATGACAACATGGACTTTTCGGAACTGGCTGGATTTCTTAGTGGACCTTCGTTTGGCATTTTTACTCCAATCGGAAAT

Full Affymetrix probeset data:

Annotations for 1640401_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720