Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640402_at:

>probe:Drosophila_2:1640402_at:275:113; Interrogation_Position=466; Antisense; AGCACTGGCTGCTCATCAAGGGCAA
>probe:Drosophila_2:1640402_at:606:221; Interrogation_Position=483; Antisense; AAGGGCAACTACTCCGGCTGCTGGT
>probe:Drosophila_2:1640402_at:614:251; Interrogation_Position=557; Antisense; CAAGTGCGTCACACACGGCGTGGTG
>probe:Drosophila_2:1640402_at:408:139; Interrogation_Position=658; Antisense; ACTGGGAGAACATCCTCGACGGGCA
>probe:Drosophila_2:1640402_at:597:567; Interrogation_Position=679; Antisense; GGCACGCGCACAACTTCAACAAGTA
>probe:Drosophila_2:1640402_at:501:147; Interrogation_Position=742; Antisense; ACTACCAGAGCGTCATGCACTACAG
>probe:Drosophila_2:1640402_at:567:631; Interrogation_Position=768; Antisense; TCGCGGGCCTTCAGCAAGAACGGGA
>probe:Drosophila_2:1640402_at:335:189; Interrogation_Position=786; Antisense; AACGGGAAAGCCACCATAGAGCCAT
>probe:Drosophila_2:1640402_at:711:25; Interrogation_Position=801; Antisense; ATAGAGCCATTGGATCCGTACGCCT
>probe:Drosophila_2:1640402_at:208:385; Interrogation_Position=885; Antisense; GAACAGGACTGCAGCGAGGACTACC
>probe:Drosophila_2:1640402_at:447:411; Interrogation_Position=921; Antisense; GACCGCTTCGGGAACTACATCGACG
>probe:Drosophila_2:1640402_at:89:667; Interrogation_Position=936; Antisense; TACATCGACGAACTGCTCGACTACT
>probe:Drosophila_2:1640402_at:559:323; Interrogation_Position=952; Antisense; TCGACTACTTCCAGGGCAACATTCA
>probe:Drosophila_2:1640402_at:176:359; Interrogation_Position=967; Antisense; GCAACATTCAGGATCTGCTCGGATA

Paste this into a BLAST search page for me
AGCACTGGCTGCTCATCAAGGGCAAAAGGGCAACTACTCCGGCTGCTGGTCAAGTGCGTCACACACGGCGTGGTGACTGGGAGAACATCCTCGACGGGCAGGCACGCGCACAACTTCAACAAGTAACTACCAGAGCGTCATGCACTACAGTCGCGGGCCTTCAGCAAGAACGGGAAACGGGAAAGCCACCATAGAGCCATATAGAGCCATTGGATCCGTACGCCTGAACAGGACTGCAGCGAGGACTACCGACCGCTTCGGGAACTACATCGACGTACATCGACGAACTGCTCGACTACTTCGACTACTTCCAGGGCAACATTCAGCAACATTCAGGATCTGCTCGGATA

Full Affymetrix probeset data:

Annotations for 1640402_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime