FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640403_at:

>probe:Drosophila_2:1640403_at:54:533; Interrogation_Position=1742; Antisense; GGTGGAGAATCATCGGGCCAAGCTC
>probe:Drosophila_2:1640403_at:330:167; Interrogation_Position=1837; Antisense; AAATGATGGAGGGTCTGCCGCCCAA
>probe:Drosophila_2:1640403_at:681:393; Interrogation_Position=1890; Antisense; GAAATGTTGGCCAGGGCAACCACCT
>probe:Drosophila_2:1640403_at:310:269; Interrogation_Position=1949; Antisense; CATGCCCACGACAACGACGGAGAAT
>probe:Drosophila_2:1640403_at:555:75; Interrogation_Position=1981; Antisense; AGGATGAGGTCCTGACTACCGCCGC
>probe:Drosophila_2:1640403_at:566:357; Interrogation_Position=2010; Antisense; GCAACGGAAGTACCGGCGTGACTTT
>probe:Drosophila_2:1640403_at:530:695; Interrogation_Position=2056; Antisense; TTTCGTTCCACTTCCATATGACTGT
>probe:Drosophila_2:1640403_at:640:15; Interrogation_Position=2097; Antisense; ATTTACCGATCGCAGCATCGCCAAG
>probe:Drosophila_2:1640403_at:47:217; Interrogation_Position=2119; Antisense; AAGTTCTCCGGCTGGAGGACCGCAG
>probe:Drosophila_2:1640403_at:339:349; Interrogation_Position=2140; Antisense; GCAGGTGCAATCACTCAGGCGCAAT
>probe:Drosophila_2:1640403_at:726:153; Interrogation_Position=2193; Antisense; ACAGAGAGCCCCAACTTCGATACGT
>probe:Drosophila_2:1640403_at:225:457; Interrogation_Position=2211; Antisense; GATACGTCCACTTTTTACACCAGAA
>probe:Drosophila_2:1640403_at:359:363; Interrogation_Position=2233; Antisense; GAATTGTTCGATTCGTCTTCTGTGC
>probe:Drosophila_2:1640403_at:463:645; Interrogation_Position=2248; Antisense; TCTTCTGTGCTACTCTCAATACTTT

Paste this into a BLAST search page for me
GGTGGAGAATCATCGGGCCAAGCTCAAATGATGGAGGGTCTGCCGCCCAAGAAATGTTGGCCAGGGCAACCACCTCATGCCCACGACAACGACGGAGAATAGGATGAGGTCCTGACTACCGCCGCGCAACGGAAGTACCGGCGTGACTTTTTTCGTTCCACTTCCATATGACTGTATTTACCGATCGCAGCATCGCCAAGAAGTTCTCCGGCTGGAGGACCGCAGGCAGGTGCAATCACTCAGGCGCAATACAGAGAGCCCCAACTTCGATACGTGATACGTCCACTTTTTACACCAGAAGAATTGTTCGATTCGTCTTCTGTGCTCTTCTGTGCTACTCTCAATACTTT

Full Affymetrix probeset data:

Annotations for 1640403_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720