FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640404_at:

>probe:Drosophila_2:1640404_at:703:243; Interrogation_Position=116; Antisense; AATTTACCCAGGACACGTGTGTCGG
>probe:Drosophila_2:1640404_at:284:135; Interrogation_Position=170; Antisense; ACGAGGATCGAGAGACCAACTTCAT
>probe:Drosophila_2:1640404_at:156:685; Interrogation_Position=210; Antisense; TATCGCATTATTCTCTTATCGTTTT
>probe:Drosophila_2:1640404_at:564:127; Interrogation_Position=251; Antisense; ACCACCCCTAAGCAGATCGAAGAGT
>probe:Drosophila_2:1640404_at:584:181; Interrogation_Position=282; Antisense; AAAAGTTCCTGAGGCGACCGGATAT
>probe:Drosophila_2:1640404_at:618:671; Interrogation_Position=332; Antisense; TACGCTGATATGATTCGACCCACTG
>probe:Drosophila_2:1640404_at:423:599; Interrogation_Position=355; Antisense; TGTCGATGCTCACAATCTGGCCGTT
>probe:Drosophila_2:1640404_at:82:579; Interrogation_Position=373; Antisense; GGCCGTTCCCACTGTGCTGGAGATT
>probe:Drosophila_2:1640404_at:437:315; Interrogation_Position=39; Antisense; GCCTTTTGGCCGTGATTGGCGATGA
>probe:Drosophila_2:1640404_at:166:589; Interrogation_Position=390; Antisense; TGGAGATTCCCTCGAAACAGCATCC
>probe:Drosophila_2:1640404_at:163:9; Interrogation_Position=420; Antisense; ATTCCTCCAGGGACTCGATTCTGAA
>probe:Drosophila_2:1640404_at:633:377; Interrogation_Position=442; Antisense; GAAGCGGGCTCAACGAGTCATCACT
>probe:Drosophila_2:1640404_at:326:425; Interrogation_Position=473; Antisense; GAGAGGCACTACTAGCGGCTCAGTT
>probe:Drosophila_2:1640404_at:366:121; Interrogation_Position=486; Antisense; AGCGGCTCAGTTTTGGCAGTCACTT

Paste this into a BLAST search page for me
AATTTACCCAGGACACGTGTGTCGGACGAGGATCGAGAGACCAACTTCATTATCGCATTATTCTCTTATCGTTTTACCACCCCTAAGCAGATCGAAGAGTAAAAGTTCCTGAGGCGACCGGATATTACGCTGATATGATTCGACCCACTGTGTCGATGCTCACAATCTGGCCGTTGGCCGTTCCCACTGTGCTGGAGATTGCCTTTTGGCCGTGATTGGCGATGATGGAGATTCCCTCGAAACAGCATCCATTCCTCCAGGGACTCGATTCTGAAGAAGCGGGCTCAACGAGTCATCACTGAGAGGCACTACTAGCGGCTCAGTTAGCGGCTCAGTTTTGGCAGTCACTT

Full Affymetrix probeset data:

Annotations for 1640404_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720