FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640405_at:

>probe:Drosophila_2:1640405_at:168:221; Interrogation_Position=1901; Antisense; AAGTGCTGTCTACGCGGATTCTGGA
>probe:Drosophila_2:1640405_at:599:631; Interrogation_Position=1927; Antisense; TCCGTAATCTGGGATCCGAGTGGTT
>probe:Drosophila_2:1640405_at:713:433; Interrogation_Position=1944; Antisense; GAGTGGTTCCCAAAAGCAGTGTCAT
>probe:Drosophila_2:1640405_at:454:497; Interrogation_Position=1964; Antisense; GTCATGCTGTATACGCAGTGGCTGT
>probe:Drosophila_2:1640405_at:119:687; Interrogation_Position=2007; Antisense; TATAGTATTCCCGATCTGGCCGATC
>probe:Drosophila_2:1640405_at:641:569; Interrogation_Position=2035; Antisense; GGCATCAGCGCCAACTAATTAATTT
>probe:Drosophila_2:1640405_at:679:291; Interrogation_Position=2062; Antisense; GCGAATTTACTTACACTCCCGAACG
>probe:Drosophila_2:1640405_at:662:85; Interrogation_Position=2092; Antisense; AGTGCTACCATGTTTATCCCTTTTG
>probe:Drosophila_2:1640405_at:725:45; Interrogation_Position=2129; Antisense; ATCCTTAGCCTAATCCTAATCCTAA
>probe:Drosophila_2:1640405_at:243:277; Interrogation_Position=2144; Antisense; CTAATCCTAAACTATACCCCTATGC
>probe:Drosophila_2:1640405_at:89:355; Interrogation_Position=2172; Antisense; GCACGCAACGTACTCTCTTAATTAT
>probe:Drosophila_2:1640405_at:35:225; Interrogation_Position=2231; Antisense; AAGGATTTCGTGTACCAGAGCTCGT
>probe:Drosophila_2:1640405_at:252:265; Interrogation_Position=2246; Antisense; CAGAGCTCGTATTGCCGTATTGTAA
>probe:Drosophila_2:1640405_at:110:329; Interrogation_Position=2327; Antisense; GCGTGTTTTTAGCTGTTCTGTTAAG

Paste this into a BLAST search page for me
AAGTGCTGTCTACGCGGATTCTGGATCCGTAATCTGGGATCCGAGTGGTTGAGTGGTTCCCAAAAGCAGTGTCATGTCATGCTGTATACGCAGTGGCTGTTATAGTATTCCCGATCTGGCCGATCGGCATCAGCGCCAACTAATTAATTTGCGAATTTACTTACACTCCCGAACGAGTGCTACCATGTTTATCCCTTTTGATCCTTAGCCTAATCCTAATCCTAACTAATCCTAAACTATACCCCTATGCGCACGCAACGTACTCTCTTAATTATAAGGATTTCGTGTACCAGAGCTCGTCAGAGCTCGTATTGCCGTATTGTAAGCGTGTTTTTAGCTGTTCTGTTAAG

Full Affymetrix probeset data:

Annotations for 1640405_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720