FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640406_at:

>probe:Drosophila_2:1640406_at:525:391; Interrogation_Position=2009; Antisense; GAAAGTGCACTTGCCACAAATCTCT
>probe:Drosophila_2:1640406_at:307:165; Interrogation_Position=2026; Antisense; AAATCTCTCATGCTTTGCACCTGTC
>probe:Drosophila_2:1640406_at:87:535; Interrogation_Position=2136; Antisense; GGTGCTCACCGATACAAGCATCAGT
>probe:Drosophila_2:1640406_at:603:427; Interrogation_Position=2167; Antisense; GAGTTTAACCTGGATGTCACACCGC
>probe:Drosophila_2:1640406_at:302:347; Interrogation_Position=2194; Antisense; GCAGGAACACGTTGGCCGAAGGCTA
>probe:Drosophila_2:1640406_at:36:615; Interrogation_Position=2237; Antisense; TGAACCATAGCACACAGACTCCGAA
>probe:Drosophila_2:1640406_at:470:37; Interrogation_Position=2274; Antisense; ATCTATAGAGCCCAAGTACCCAGTT
>probe:Drosophila_2:1640406_at:643:307; Interrogation_Position=2293; Antisense; CCAGTTTCCGATAGTCCCTATTGGA
>probe:Drosophila_2:1640406_at:436:3; Interrogation_Position=2312; Antisense; ATTGGAGGGCCTTCGATTGCGCAGC
>probe:Drosophila_2:1640406_at:503:527; Interrogation_Position=2337; Antisense; GGGAGATCGCTATATGGGCACCGCC
>probe:Drosophila_2:1640406_at:532:79; Interrogation_Position=2418; Antisense; AGGTCAGCATGGAAAGGCTCCCTGT
>probe:Drosophila_2:1640406_at:279:207; Interrogation_Position=2467; Antisense; AAGCGTACAGGTGCACCAATGCCAA
>probe:Drosophila_2:1640406_at:555:729; Interrogation_Position=2492; Antisense; TTGGCACCGGTCATGATGCTATCGA
>probe:Drosophila_2:1640406_at:198:685; Interrogation_Position=2511; Antisense; TATCGATCCATATAGGTTCACCAGA

Paste this into a BLAST search page for me
GAAAGTGCACTTGCCACAAATCTCTAAATCTCTCATGCTTTGCACCTGTCGGTGCTCACCGATACAAGCATCAGTGAGTTTAACCTGGATGTCACACCGCGCAGGAACACGTTGGCCGAAGGCTATGAACCATAGCACACAGACTCCGAAATCTATAGAGCCCAAGTACCCAGTTCCAGTTTCCGATAGTCCCTATTGGAATTGGAGGGCCTTCGATTGCGCAGCGGGAGATCGCTATATGGGCACCGCCAGGTCAGCATGGAAAGGCTCCCTGTAAGCGTACAGGTGCACCAATGCCAATTGGCACCGGTCATGATGCTATCGATATCGATCCATATAGGTTCACCAGA

Full Affymetrix probeset data:

Annotations for 1640406_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720