FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640407_at:

>probe:Drosophila_2:1640407_at:386:533; Interrogation_Position=157; Antisense; GGTGGTGCCATTATCTCGAAGAACT
>probe:Drosophila_2:1640407_at:13:605; Interrogation_Position=172; Antisense; TCGAAGAACTACATCCTGACTGCCG
>probe:Drosophila_2:1640407_at:302:323; Interrogation_Position=218; Antisense; GCGCCAGGAGCATACAAGTCAGGTT
>probe:Drosophila_2:1640407_at:689:113; Interrogation_Position=250; Antisense; AGCAGCTGCGGCACTAGTGGATCAA
>probe:Drosophila_2:1640407_at:125:217; Interrogation_Position=296; Antisense; AAGTTCATAGCCAGTACTCCAGCTG
>probe:Drosophila_2:1640407_at:177:577; Interrogation_Position=320; Antisense; GGCGCTTTGACAATAACTTGGCTCT
>probe:Drosophila_2:1640407_at:579:147; Interrogation_Position=335; Antisense; ACTTGGCTCTCTTGAAAACCTGCGA
>probe:Drosophila_2:1640407_at:368:507; Interrogation_Position=409; Antisense; GTGCCGGATGATAATTCTCGAGCCA
>probe:Drosophila_2:1640407_at:729:213; Interrogation_Position=455; Antisense; AAGAGAAGTGCTTCCAGCTGCCTGT
>probe:Drosophila_2:1640407_at:622:597; Interrogation_Position=477; Antisense; TGTCCAATTGCACGGCACTCAAGTG
>probe:Drosophila_2:1640407_at:189:145; Interrogation_Position=493; Antisense; ACTCAAGTGCGGATCCTTAGCCAAA
>probe:Drosophila_2:1640407_at:567:703; Interrogation_Position=509; Antisense; TTAGCCAAAAACAGTGCGCCGCCGA
>probe:Drosophila_2:1640407_at:237:273; Interrogation_Position=687; Antisense; CATTAAGCCCGATGTCTATGCAAAT
>probe:Drosophila_2:1640407_at:376:383; Interrogation_Position=726; Antisense; GAACTGGCTGGACTCGAATACGAAG

Paste this into a BLAST search page for me
GGTGGTGCCATTATCTCGAAGAACTTCGAAGAACTACATCCTGACTGCCGGCGCCAGGAGCATACAAGTCAGGTTAGCAGCTGCGGCACTAGTGGATCAAAAGTTCATAGCCAGTACTCCAGCTGGGCGCTTTGACAATAACTTGGCTCTACTTGGCTCTCTTGAAAACCTGCGAGTGCCGGATGATAATTCTCGAGCCAAAGAGAAGTGCTTCCAGCTGCCTGTTGTCCAATTGCACGGCACTCAAGTGACTCAAGTGCGGATCCTTAGCCAAATTAGCCAAAAACAGTGCGCCGCCGACATTAAGCCCGATGTCTATGCAAATGAACTGGCTGGACTCGAATACGAAG

Full Affymetrix probeset data:

Annotations for 1640407_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720