FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640409_at:

>probe:Drosophila_2:1640409_at:20:351; Interrogation_Position=3633; Antisense; GCAGTATATAGCCTCACACACACAC
>probe:Drosophila_2:1640409_at:119:689; Interrogation_Position=3665; Antisense; TATATTTTTGACTTGATCTTGGACA
>probe:Drosophila_2:1640409_at:579:23; Interrogation_Position=3723; Antisense; ATATGTGCGGTTTTCACTCGAGTCG
>probe:Drosophila_2:1640409_at:436:145; Interrogation_Position=3738; Antisense; ACTCGAGTCGAGCTTAAGGCAGGAA
>probe:Drosophila_2:1640409_at:230:535; Interrogation_Position=3786; Antisense; GGTCGGACCACTTTTATAGAGCCAT
>probe:Drosophila_2:1640409_at:343:591; Interrogation_Position=3904; Antisense; TGGGTTGTTATGCTGAAGCCATGTA
>probe:Drosophila_2:1640409_at:71:31; Interrogation_Position=3977; Antisense; ATAAGCAATCTTCTGTGGAATGACA
>probe:Drosophila_2:1640409_at:613:519; Interrogation_Position=3991; Antisense; GTGGAATGACAACCCACATGCCCGT
>probe:Drosophila_2:1640409_at:173:153; Interrogation_Position=4006; Antisense; ACATGCCCGTTGTTCGAGTATTTGG
>probe:Drosophila_2:1640409_at:400:689; Interrogation_Position=4026; Antisense; TTTGGCAACCCTATCTAGTATACCC
>probe:Drosophila_2:1640409_at:288:443; Interrogation_Position=4058; Antisense; GATGAATTTTCGGTGAATGCCTTTT
>probe:Drosophila_2:1640409_at:163:235; Interrogation_Position=4073; Antisense; AATGCCTTTTAGTCGTTCTCTTTAG
>probe:Drosophila_2:1640409_at:333:497; Interrogation_Position=4084; Antisense; GTCGTTCTCTTTAGTACTTAGACCA
>probe:Drosophila_2:1640409_at:228:301; Interrogation_Position=4114; Antisense; CCCACAGCCTTTCAATCACATAAAA

Paste this into a BLAST search page for me
GCAGTATATAGCCTCACACACACACTATATTTTTGACTTGATCTTGGACAATATGTGCGGTTTTCACTCGAGTCGACTCGAGTCGAGCTTAAGGCAGGAAGGTCGGACCACTTTTATAGAGCCATTGGGTTGTTATGCTGAAGCCATGTAATAAGCAATCTTCTGTGGAATGACAGTGGAATGACAACCCACATGCCCGTACATGCCCGTTGTTCGAGTATTTGGTTTGGCAACCCTATCTAGTATACCCGATGAATTTTCGGTGAATGCCTTTTAATGCCTTTTAGTCGTTCTCTTTAGGTCGTTCTCTTTAGTACTTAGACCACCCACAGCCTTTCAATCACATAAAA

Full Affymetrix probeset data:

Annotations for 1640409_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720