FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640410_at:

>probe:Drosophila_2:1640410_at:699:671; Interrogation_Position=261; Antisense; TACGCATCCCAGTTATAGGTCGATT
>probe:Drosophila_2:1640410_at:28:23; Interrogation_Position=330; Antisense; ATATACAGTTGCCATTCGTCCCATA
>probe:Drosophila_2:1640410_at:575:503; Interrogation_Position=347; Antisense; GTCCCATATGTTTGGTATTGCCTGA
>probe:Drosophila_2:1640410_at:532:473; Interrogation_Position=406; Antisense; GTAGAAGACTTCACTCTTACCGGCT
>probe:Drosophila_2:1640410_at:158:531; Interrogation_Position=432; Antisense; GGGTGCGACCAAAACTGAACCTGTT
>probe:Drosophila_2:1640410_at:708:559; Interrogation_Position=499; Antisense; GGAACCTGTCACGATCGGTACGGAC
>probe:Drosophila_2:1640410_at:533:401; Interrogation_Position=521; Antisense; GACATTCTGTCGATCATACCCACAT
>probe:Drosophila_2:1640410_at:635:27; Interrogation_Position=536; Antisense; ATACCCACATCTGTGCCGGAAGTAG
>probe:Drosophila_2:1640410_at:433:145; Interrogation_Position=584; Antisense; ACTCTGGCAGTCCACTTGCAATGAA
>probe:Drosophila_2:1640410_at:187:457; Interrogation_Position=626; Antisense; GATACATTCACGCTCAAGTGGGAAT
>probe:Drosophila_2:1640410_at:98:363; Interrogation_Position=647; Antisense; GAATTGTTAGCCGTGGGCCCAAGAA
>probe:Drosophila_2:1640410_at:331:551; Interrogation_Position=679; Antisense; GGAGTTACTGTCTTCACAAACGTTG
>probe:Drosophila_2:1640410_at:623:197; Interrogation_Position=697; Antisense; AACGTTGTAAGCTTCACCGAGTGGA
>probe:Drosophila_2:1640410_at:154:691; Interrogation_Position=724; Antisense; TTCAGGACCACTTTATACGACGCGA

Paste this into a BLAST search page for me
TACGCATCCCAGTTATAGGTCGATTATATACAGTTGCCATTCGTCCCATAGTCCCATATGTTTGGTATTGCCTGAGTAGAAGACTTCACTCTTACCGGCTGGGTGCGACCAAAACTGAACCTGTTGGAACCTGTCACGATCGGTACGGACGACATTCTGTCGATCATACCCACATATACCCACATCTGTGCCGGAAGTAGACTCTGGCAGTCCACTTGCAATGAAGATACATTCACGCTCAAGTGGGAATGAATTGTTAGCCGTGGGCCCAAGAAGGAGTTACTGTCTTCACAAACGTTGAACGTTGTAAGCTTCACCGAGTGGATTCAGGACCACTTTATACGACGCGA

Full Affymetrix probeset data:

Annotations for 1640410_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720