FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640411_at:

>probe:Drosophila_2:1640411_at:329:275; Interrogation_Position=1320; Antisense; CTTCGACTTCACGATCTCAAAGGAC
>probe:Drosophila_2:1640411_at:277:711; Interrogation_Position=1327; Antisense; TTCACGATCTCAAAGGACGTTCGAT
>probe:Drosophila_2:1640411_at:721:279; Interrogation_Position=1335; Antisense; CTCAAAGGACGTTCGATCCTTGGTC
>probe:Drosophila_2:1640411_at:12:273; Interrogation_Position=1353; Antisense; CTTGGTCTACGATCGTGTAATAAGT
>probe:Drosophila_2:1640411_at:16:139; Interrogation_Position=1361; Antisense; ACGATCGTGTAATAAGTCTTTGTGG
>probe:Drosophila_2:1640411_at:303:31; Interrogation_Position=1372; Antisense; ATAAGTCTTTGTGGTTCTAATCGTT
>probe:Drosophila_2:1640411_at:245:497; Interrogation_Position=1376; Antisense; GTCTTTGTGGTTCTAATCGTTAAAT
>probe:Drosophila_2:1640411_at:373:531; Interrogation_Position=1381; Antisense; TGTGGTTCTAATCGTTAAATGCTTA
>probe:Drosophila_2:1640411_at:1:457; Interrogation_Position=1406; Antisense; GATAACAAATTGTACTCTTAGCTTA
>probe:Drosophila_2:1640411_at:585:489; Interrogation_Position=1417; Antisense; GTACTCTTAGCTTACAACTGAAATA
>probe:Drosophila_2:1640411_at:130:281; Interrogation_Position=864; Antisense; GTTGTTGAATCTCTTGGGCGGCCAC
>probe:Drosophila_2:1640411_at:74:469; Interrogation_Position=867; Antisense; GTTGAATCTCTTGGGCGGCCACAAG
>probe:Drosophila_2:1640411_at:466:37; Interrogation_Position=892; Antisense; ATCTCCCTGAAAAACAAGATTGTTG
>probe:Drosophila_2:1640411_at:221:181; Interrogation_Position=903; Antisense; AAACAAGATTGTTGACATGTTCCGT

Paste this into a BLAST search page for me
CTTCGACTTCACGATCTCAAAGGACTTCACGATCTCAAAGGACGTTCGATCTCAAAGGACGTTCGATCCTTGGTCCTTGGTCTACGATCGTGTAATAAGTACGATCGTGTAATAAGTCTTTGTGGATAAGTCTTTGTGGTTCTAATCGTTGTCTTTGTGGTTCTAATCGTTAAATTGTGGTTCTAATCGTTAAATGCTTAGATAACAAATTGTACTCTTAGCTTAGTACTCTTAGCTTACAACTGAAATAGTTGTTGAATCTCTTGGGCGGCCACGTTGAATCTCTTGGGCGGCCACAAGATCTCCCTGAAAAACAAGATTGTTGAAACAAGATTGTTGACATGTTCCGT

Full Affymetrix probeset data:

Annotations for 1640411_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720