FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640412_at:

>probe:Drosophila_2:1640412_at:496:505; Interrogation_Position=2276; Antisense; GTGCCGAAGATGATTGGTTGCTGAA
>probe:Drosophila_2:1640412_at:550:457; Interrogation_Position=2344; Antisense; GATATTCTAACTCGTCTTATTTAAA
>probe:Drosophila_2:1640412_at:211:243; Interrogation_Position=2418; Antisense; AATTAGCTTCTATCAACTACGTTGT
>probe:Drosophila_2:1640412_at:376:393; Interrogation_Position=2470; Antisense; GACAAAATTCTTTCCACTTGTCCGG
>probe:Drosophila_2:1640412_at:453:305; Interrogation_Position=2491; Antisense; CCGGCCCTTTTTGCATTGTACATAG
>probe:Drosophila_2:1640412_at:176:203; Interrogation_Position=2520; Antisense; AACCAACCCAATTGAACCTCTGATA
>probe:Drosophila_2:1640412_at:527:17; Interrogation_Position=2613; Antisense; ATTTATACCTTCTGCATCTATTGCG
>probe:Drosophila_2:1640412_at:333:345; Interrogation_Position=2626; Antisense; GCATCTATTGCGATACTGAACTTAA
>probe:Drosophila_2:1640412_at:164:207; Interrogation_Position=2738; Antisense; AAGCAATGTCCTGTTATCTAGTTAG
>probe:Drosophila_2:1640412_at:34:35; Interrogation_Position=2753; Antisense; ATCTAGTTAGGTTATTTTCAAGGCA
>probe:Drosophila_2:1640412_at:222:73; Interrogation_Position=2773; Antisense; AGGCAATTATTCACAGCTCTCAGAT
>probe:Drosophila_2:1640412_at:249:155; Interrogation_Position=2785; Antisense; ACAGCTCTCAGATTCCAACGATTGA
>probe:Drosophila_2:1640412_at:14:479; Interrogation_Position=2814; Antisense; GTTTAATCTCAACTCTTTACCAAAG
>probe:Drosophila_2:1640412_at:314:355; Interrogation_Position=2838; Antisense; GAAGTCCATTTGTACTAGTGTAAAA

Paste this into a BLAST search page for me
GTGCCGAAGATGATTGGTTGCTGAAGATATTCTAACTCGTCTTATTTAAAAATTAGCTTCTATCAACTACGTTGTGACAAAATTCTTTCCACTTGTCCGGCCGGCCCTTTTTGCATTGTACATAGAACCAACCCAATTGAACCTCTGATAATTTATACCTTCTGCATCTATTGCGGCATCTATTGCGATACTGAACTTAAAAGCAATGTCCTGTTATCTAGTTAGATCTAGTTAGGTTATTTTCAAGGCAAGGCAATTATTCACAGCTCTCAGATACAGCTCTCAGATTCCAACGATTGAGTTTAATCTCAACTCTTTACCAAAGGAAGTCCATTTGTACTAGTGTAAAA

Full Affymetrix probeset data:

Annotations for 1640412_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720