Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640415_at:

>probe:Drosophila_2:1640415_at:56:51; Interrogation_Position=1525; Antisense; ATGCCCTACCGATTCGCGATTGCGA
>probe:Drosophila_2:1640415_at:509:635; Interrogation_Position=1538; Antisense; TCGCGATTGCGACCTGATATATTAC
>probe:Drosophila_2:1640415_at:230:207; Interrogation_Position=1572; Antisense; AAGGTAACTTGGATGGTGCCTCCAA
>probe:Drosophila_2:1640415_at:268:551; Interrogation_Position=1597; Antisense; GGAGAAGACCCGTCTCGAGGAGAAA
>probe:Drosophila_2:1640415_at:253:169; Interrogation_Position=1641; Antisense; AAAGGAAGTCCACCAATAGCGATGA
>probe:Drosophila_2:1640415_at:597:553; Interrogation_Position=1744; Antisense; GGACCGCAAATACGACAACACCGAT
>probe:Drosophila_2:1640415_at:496:661; Interrogation_Position=1778; Antisense; TAGAACCATTTTGTAGCGGGCTTAC
>probe:Drosophila_2:1640415_at:397:329; Interrogation_Position=1793; Antisense; GCGGGCTTACGCTTACAGTATATAT
>probe:Drosophila_2:1640415_at:200:113; Interrogation_Position=1891; Antisense; AGCAGGCAAAGCATTCCAAATCCCG
>probe:Drosophila_2:1640415_at:560:301; Interrogation_Position=1916; Antisense; CCGTTTGATACCGTCACGTTCATAT
>probe:Drosophila_2:1640415_at:290:55; Interrogation_Position=1941; Antisense; ATGACCACGTGATTGTACGATCTGG
>probe:Drosophila_2:1640415_at:264:131; Interrogation_Position=1977; Antisense; ACCTCAGTCAATCAAGTCGCACAAG
>probe:Drosophila_2:1640415_at:407:195; Interrogation_Position=2024; Antisense; AACGCTTACTTTTCGTAGTCTCTAT
>probe:Drosophila_2:1640415_at:361:511; Interrogation_Position=2075; Antisense; GTGACGATTCCATACGAAGCTATTA

Paste this into a BLAST search page for me
ATGCCCTACCGATTCGCGATTGCGATCGCGATTGCGACCTGATATATTACAAGGTAACTTGGATGGTGCCTCCAAGGAGAAGACCCGTCTCGAGGAGAAAAAAGGAAGTCCACCAATAGCGATGAGGACCGCAAATACGACAACACCGATTAGAACCATTTTGTAGCGGGCTTACGCGGGCTTACGCTTACAGTATATATAGCAGGCAAAGCATTCCAAATCCCGCCGTTTGATACCGTCACGTTCATATATGACCACGTGATTGTACGATCTGGACCTCAGTCAATCAAGTCGCACAAGAACGCTTACTTTTCGTAGTCTCTATGTGACGATTCCATACGAAGCTATTA

Full Affymetrix probeset data:

Annotations for 1640415_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime