FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640416_at:

>probe:Drosophila_2:1640416_at:236:105; Interrogation_Position=110; Antisense; AGACGCACGTGTTGCAGTGCGCCAA
>probe:Drosophila_2:1640416_at:201:85; Interrogation_Position=125; Antisense; AGTGCGCCAAGAACTTTCCTTTGGA
>probe:Drosophila_2:1640416_at:61:535; Interrogation_Position=156; Antisense; GGTGCACTGTCCATATAACTGCGGT
>probe:Drosophila_2:1640416_at:525:327; Interrogation_Position=176; Antisense; GCGGTCAAATACACTCGGTTGCCGA
>probe:Drosophila_2:1640416_at:460:207; Interrogation_Position=21; Antisense; AAGCAACGCATCTGTGGAAGGTCCC
>probe:Drosophila_2:1640416_at:723:27; Interrogation_Position=261; Antisense; ATCTCAGACGTACAACCCTAGTCTT
>probe:Drosophila_2:1640416_at:509:133; Interrogation_Position=275; Antisense; ACCCTAGTCTTCACTGCGAGAGGAG
>probe:Drosophila_2:1640416_at:160:553; Interrogation_Position=296; Antisense; GGAGCATGGTTATCCGTACCATACA
>probe:Drosophila_2:1640416_at:482:271; Interrogation_Position=315; Antisense; CATACATGGAGCTACACGATCCGCT
>probe:Drosophila_2:1640416_at:155:47; Interrogation_Position=333; Antisense; ATCCGCTCGTCGAGAATTCCGCAAA
>probe:Drosophila_2:1640416_at:311:311; Interrogation_Position=40; Antisense; GGTCCCCGTTTTGAGGAGCACCTAG
>probe:Drosophila_2:1640416_at:693:351; Interrogation_Position=57; Antisense; GCACCTAGTCTGTCCATTCGATGGA
>probe:Drosophila_2:1640416_at:639:461; Interrogation_Position=80; Antisense; GATTACATCGCATATTGCCGCTCGA
>probe:Drosophila_2:1640416_at:94:625; Interrogation_Position=95; Antisense; TGCCGCTCGATATGAAGACGCACGT

Paste this into a BLAST search page for me
AGACGCACGTGTTGCAGTGCGCCAAAGTGCGCCAAGAACTTTCCTTTGGAGGTGCACTGTCCATATAACTGCGGTGCGGTCAAATACACTCGGTTGCCGAAAGCAACGCATCTGTGGAAGGTCCCATCTCAGACGTACAACCCTAGTCTTACCCTAGTCTTCACTGCGAGAGGAGGGAGCATGGTTATCCGTACCATACACATACATGGAGCTACACGATCCGCTATCCGCTCGTCGAGAATTCCGCAAAGGTCCCCGTTTTGAGGAGCACCTAGGCACCTAGTCTGTCCATTCGATGGAGATTACATCGCATATTGCCGCTCGATGCCGCTCGATATGAAGACGCACGT

Full Affymetrix probeset data:

Annotations for 1640416_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720