Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640418_at:

>probe:Drosophila_2:1640418_at:717:131; Interrogation_Position=3493; Antisense; ACCGATTTCGCTCACGGGAGGACTC
>probe:Drosophila_2:1640418_at:203:275; Interrogation_Position=3538; Antisense; CATTGTCACGAATCCGAGCGACCAA
>probe:Drosophila_2:1640418_at:403:553; Interrogation_Position=3581; Antisense; GGAGCAGCGCAATCTCAAGCACCTA
>probe:Drosophila_2:1640418_at:208:111; Interrogation_Position=3598; Antisense; AGCACCTACACCCATGGATACTACA
>probe:Drosophila_2:1640418_at:210:121; Interrogation_Position=3632; Antisense; AGCGGTCCAGTGTCAGATGCCAACG
>probe:Drosophila_2:1640418_at:660:301; Interrogation_Position=3728; Antisense; CCCTCTTCTTAACTCTTACTCATAA
>probe:Drosophila_2:1640418_at:581:241; Interrogation_Position=3772; Antisense; AATAGCTCTAAGTCGTACGCTCTCA
>probe:Drosophila_2:1640418_at:682:87; Interrogation_Position=3782; Antisense; AGTCGTACGCTCTCAGTATGTATTA
>probe:Drosophila_2:1640418_at:688:705; Interrogation_Position=3804; Antisense; TTATGTATACTCCACTTTAAGCCCA
>probe:Drosophila_2:1640418_at:374:321; Interrogation_Position=3824; Antisense; GCCCAACTCTTGTGTGTAATCTGAA
>probe:Drosophila_2:1640418_at:541:425; Interrogation_Position=3850; Antisense; GAGATGCACTACACATTGACGCGTC
>probe:Drosophila_2:1640418_at:135:609; Interrogation_Position=3866; Antisense; TGACGCGTCTCCAGTTTTGTGTAAG
>probe:Drosophila_2:1640418_at:157:511; Interrogation_Position=3885; Antisense; TGTAAGTTTCATTTCGTGTCCGGTC
>probe:Drosophila_2:1640418_at:154:599; Interrogation_Position=3901; Antisense; TGTCCGGTCGCGTTTACAAGCAATT

Paste this into a BLAST search page for me
ACCGATTTCGCTCACGGGAGGACTCCATTGTCACGAATCCGAGCGACCAAGGAGCAGCGCAATCTCAAGCACCTAAGCACCTACACCCATGGATACTACAAGCGGTCCAGTGTCAGATGCCAACGCCCTCTTCTTAACTCTTACTCATAAAATAGCTCTAAGTCGTACGCTCTCAAGTCGTACGCTCTCAGTATGTATTATTATGTATACTCCACTTTAAGCCCAGCCCAACTCTTGTGTGTAATCTGAAGAGATGCACTACACATTGACGCGTCTGACGCGTCTCCAGTTTTGTGTAAGTGTAAGTTTCATTTCGTGTCCGGTCTGTCCGGTCGCGTTTACAAGCAATT

Full Affymetrix probeset data:

Annotations for 1640418_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime