FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640419_at:

>probe:Drosophila_2:1640419_at:214:423; Interrogation_Position=6130; Antisense; GAGAACGGAGCGATGCCGCCGCACT
>probe:Drosophila_2:1640419_at:644:329; Interrogation_Position=6185; Antisense; GCGTGGAAGCACAGTCGCAGCACTT
>probe:Drosophila_2:1640419_at:66:305; Interrogation_Position=6218; Antisense; CCGGCAGCAAGAACGTCCAGGACAA
>probe:Drosophila_2:1640419_at:606:159; Interrogation_Position=6239; Antisense; ACAACGAGCGCCTGGTGGCCGAAGT
>probe:Drosophila_2:1640419_at:437:373; Interrogation_Position=6259; Antisense; GAAGTCGGTCAGTCGCTGCGTCAGA
>probe:Drosophila_2:1640419_at:95:497; Interrogation_Position=6278; Antisense; GTCAGATCTCCAATGCGCTTAACAG
>probe:Drosophila_2:1640419_at:717:293; Interrogation_Position=6333; Antisense; CGACCAACATCAGGGCATCTGGCTG
>probe:Drosophila_2:1640419_at:687:565; Interrogation_Position=6353; Antisense; GGCTGGATGCCGAGGGTAACTTCAT
>probe:Drosophila_2:1640419_at:276:1; Interrogation_Position=6376; Antisense; ATTAAGCGCAAGTGATCGGGCCCCA
>probe:Drosophila_2:1640419_at:44:513; Interrogation_Position=6387; Antisense; GTGATCGGGCCCCAATTTGTAGACC
>probe:Drosophila_2:1640419_at:461:17; Interrogation_Position=6401; Antisense; ATTTGTAGACCCAATCGTCCAACCA
>probe:Drosophila_2:1640419_at:629:547; Interrogation_Position=6576; Antisense; GGAGGACACCTATGTATCGTACTTG
>probe:Drosophila_2:1640419_at:408:679; Interrogation_Position=6645; Antisense; TAGTCAGATCTGTGCAGAGCCCCGA
>probe:Drosophila_2:1640419_at:235:393; Interrogation_Position=6668; Antisense; GACGAACGCTTCCAGAAAACCAAGA

Paste this into a BLAST search page for me
GAGAACGGAGCGATGCCGCCGCACTGCGTGGAAGCACAGTCGCAGCACTTCCGGCAGCAAGAACGTCCAGGACAAACAACGAGCGCCTGGTGGCCGAAGTGAAGTCGGTCAGTCGCTGCGTCAGAGTCAGATCTCCAATGCGCTTAACAGCGACCAACATCAGGGCATCTGGCTGGGCTGGATGCCGAGGGTAACTTCATATTAAGCGCAAGTGATCGGGCCCCAGTGATCGGGCCCCAATTTGTAGACCATTTGTAGACCCAATCGTCCAACCAGGAGGACACCTATGTATCGTACTTGTAGTCAGATCTGTGCAGAGCCCCGAGACGAACGCTTCCAGAAAACCAAGA

Full Affymetrix probeset data:

Annotations for 1640419_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720