Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640421_at:

>probe:Drosophila_2:1640421_at:225:203; Interrogation_Position=1013; Antisense; AACCAGGTACTCTTTATGCATATTG
>probe:Drosophila_2:1640421_at:413:241; Interrogation_Position=1138; Antisense; AATACTCTCCATTCAATAATCGCAT
>probe:Drosophila_2:1640421_at:595:363; Interrogation_Position=1214; Antisense; GAATTCTAGGACAAACTTTGCTTAT
>probe:Drosophila_2:1640421_at:321:387; Interrogation_Position=1244; Antisense; GAAAAATACTTTGTCAGCAGCAGAA
>probe:Drosophila_2:1640421_at:716:179; Interrogation_Position=1279; Antisense; AAACAATTGCTTAGCCAGCGAACTT
>probe:Drosophila_2:1640421_at:638:259; Interrogation_Position=1294; Antisense; CAGCGAACTTGACCCAATGTTTCCA
>probe:Drosophila_2:1640421_at:118:271; Interrogation_Position=1331; Antisense; CATAGATTACTTTTCGTGACCCCGA
>probe:Drosophila_2:1640421_at:148:351; Interrogation_Position=1375; Antisense; GCAAACCACTTTGACTAATGGCATT
>probe:Drosophila_2:1640421_at:541:699; Interrogation_Position=1422; Antisense; TTTATTATATACTCTCCTCCTGTCC
>probe:Drosophila_2:1640421_at:451:505; Interrogation_Position=1443; Antisense; GTCCACCTCATCATTGTTGTGCAAA
>probe:Drosophila_2:1640421_at:602:357; Interrogation_Position=1463; Antisense; GCAAATTCGTTGTTCTAGTTGTAAT
>probe:Drosophila_2:1640421_at:452:659; Interrogation_Position=1490; Antisense; TAAGCTGAAATTTGTTGCGCGCCGC
>probe:Drosophila_2:1640421_at:521:469; Interrogation_Position=1503; Antisense; GTTGCGCGCCGCTTCACGGTCGAGA
>probe:Drosophila_2:1640421_at:580:683; Interrogation_Position=1571; Antisense; TATGCGGGTATATTGTATTTTCACA

Paste this into a BLAST search page for me
AACCAGGTACTCTTTATGCATATTGAATACTCTCCATTCAATAATCGCATGAATTCTAGGACAAACTTTGCTTATGAAAAATACTTTGTCAGCAGCAGAAAAACAATTGCTTAGCCAGCGAACTTCAGCGAACTTGACCCAATGTTTCCACATAGATTACTTTTCGTGACCCCGAGCAAACCACTTTGACTAATGGCATTTTTATTATATACTCTCCTCCTGTCCGTCCACCTCATCATTGTTGTGCAAAGCAAATTCGTTGTTCTAGTTGTAATTAAGCTGAAATTTGTTGCGCGCCGCGTTGCGCGCCGCTTCACGGTCGAGATATGCGGGTATATTGTATTTTCACA

Full Affymetrix probeset data:

Annotations for 1640421_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime