Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640422_a_at:

>probe:Drosophila_2:1640422_a_at:693:431; Interrogation_Position=1037; Antisense; GAGTGCCCACGAAGGTGCATTCATA
>probe:Drosophila_2:1640422_a_at:216:725; Interrogation_Position=1072; Antisense; TTGAAGGCACCACCGGCTCATATTA
>probe:Drosophila_2:1640422_a_at:547:375; Interrogation_Position=1111; Antisense; GAAGACTCCTACACGGACGCTGATG
>probe:Drosophila_2:1640422_a_at:141:391; Interrogation_Position=561; Antisense; GAAACCGCAAGTTACCATCAGCACA
>probe:Drosophila_2:1640422_a_at:521:111; Interrogation_Position=580; Antisense; AGCACAAAATCGTCGGCTTCGTCTG
>probe:Drosophila_2:1640422_a_at:501:569; Interrogation_Position=594; Antisense; GGCTTCGTCTGTCATTTCTAAATCA
>probe:Drosophila_2:1640422_a_at:275:331; Interrogation_Position=636; Antisense; GCTGGATTTGAAACCCCTGAAACAG
>probe:Drosophila_2:1640422_a_at:607:1; Interrogation_Position=676; Antisense; ATTAATGGTCATCCGGTAACGTGCA
>probe:Drosophila_2:1640422_a_at:380:657; Interrogation_Position=692; Antisense; TAACGTGCACCCAGGATCCAGTCGA
>probe:Drosophila_2:1640422_a_at:332:229; Interrogation_Position=780; Antisense; AATGGTTTCGCCTGACAGTGAGCAA
>probe:Drosophila_2:1640422_a_at:191:417; Interrogation_Position=810; Antisense; GAGCGCTTGGTTGCATATATTCAAT
>probe:Drosophila_2:1640422_a_at:465:329; Interrogation_Position=835; Antisense; GCGGGAATTCTGAACTTCACTCTGA
>probe:Drosophila_2:1640422_a_at:671:449; Interrogation_Position=904; Antisense; GATCGCCTGCCGTTGTGGCAAATTA
>probe:Drosophila_2:1640422_a_at:387:557; Interrogation_Position=991; Antisense; GGACAGCCGGCGACAGGACACATGA

Paste this into a BLAST search page for me
GAGTGCCCACGAAGGTGCATTCATATTGAAGGCACCACCGGCTCATATTAGAAGACTCCTACACGGACGCTGATGGAAACCGCAAGTTACCATCAGCACAAGCACAAAATCGTCGGCTTCGTCTGGGCTTCGTCTGTCATTTCTAAATCAGCTGGATTTGAAACCCCTGAAACAGATTAATGGTCATCCGGTAACGTGCATAACGTGCACCCAGGATCCAGTCGAAATGGTTTCGCCTGACAGTGAGCAAGAGCGCTTGGTTGCATATATTCAATGCGGGAATTCTGAACTTCACTCTGAGATCGCCTGCCGTTGTGGCAAATTAGGACAGCCGGCGACAGGACACATGA

Full Affymetrix probeset data:

Annotations for 1640422_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime