FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640423_at:

>probe:Drosophila_2:1640423_at:184:611; Interrogation_Position=1774; Antisense; TTTCAAGTCCTTTTGGCCTCCAGTT
>probe:Drosophila_2:1640423_at:12:359; Interrogation_Position=1805; Antisense; GCAACAGCTGTTGCGCCTTGGCGTG
>probe:Drosophila_2:1640423_at:210:557; Interrogation_Position=1864; Antisense; GGACGATACCGACGATGCTGGCCAT
>probe:Drosophila_2:1640423_at:228:581; Interrogation_Position=1882; Antisense; TGGCCATCCCCTTGGACAGTGGAAG
>probe:Drosophila_2:1640423_at:208:521; Interrogation_Position=1900; Antisense; GTGGAAGCCCAGTAACAGTTACACT
>probe:Drosophila_2:1640423_at:562:185; Interrogation_Position=1980; Antisense; AACAAGGAGCATTTTTCGGCCGCCA
>probe:Drosophila_2:1640423_at:7:89; Interrogation_Position=2004; Antisense; AGTCGTCGGCAACATATGGCCCGAA
>probe:Drosophila_2:1640423_at:109:19; Interrogation_Position=2087; Antisense; ATTTCTATATAATTTCTGGCCTCAG
>probe:Drosophila_2:1640423_at:118:317; Interrogation_Position=2105; Antisense; GCCTCAGACCGAAAACAGCCAGATA
>probe:Drosophila_2:1640423_at:654:559; Interrogation_Position=2145; Antisense; GGAAAAACTGTAACTCGGCACTCGT
>probe:Drosophila_2:1640423_at:18:655; Interrogation_Position=2155; Antisense; TAACTCGGCACTCGTCTAATCTGGG
>probe:Drosophila_2:1640423_at:484:221; Interrogation_Position=2182; Antisense; AAGTGTTTGTTTAGGCGCTGGCGAT
>probe:Drosophila_2:1640423_at:436:33; Interrogation_Position=2240; Antisense; ATCAAATTCCACATATCAACACCGC
>probe:Drosophila_2:1640423_at:158:157; Interrogation_Position=2258; Antisense; ACACCGCAGCGGTCATTGATAAAAT

Paste this into a BLAST search page for me
TTTCAAGTCCTTTTGGCCTCCAGTTGCAACAGCTGTTGCGCCTTGGCGTGGGACGATACCGACGATGCTGGCCATTGGCCATCCCCTTGGACAGTGGAAGGTGGAAGCCCAGTAACAGTTACACTAACAAGGAGCATTTTTCGGCCGCCAAGTCGTCGGCAACATATGGCCCGAAATTTCTATATAATTTCTGGCCTCAGGCCTCAGACCGAAAACAGCCAGATAGGAAAAACTGTAACTCGGCACTCGTTAACTCGGCACTCGTCTAATCTGGGAAGTGTTTGTTTAGGCGCTGGCGATATCAAATTCCACATATCAACACCGCACACCGCAGCGGTCATTGATAAAAT

Full Affymetrix probeset data:

Annotations for 1640423_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720