FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640424_at:

>probe:Drosophila_2:1640424_at:55:719; Interrogation_Position=122; Antisense; TTCGCATCGAACTGGTGAACCGGCT
>probe:Drosophila_2:1640424_at:605:613; Interrogation_Position=137; Antisense; TGAACCGGCTGCATGGAATCCAACT
>probe:Drosophila_2:1640424_at:226:123; Interrogation_Position=164; Antisense; AGCGCAAGTTGCGTCGACTACTGCT
>probe:Drosophila_2:1640424_at:478:669; Interrogation_Position=182; Antisense; TACTGCTGCTCATGTTCCTATCTAT
>probe:Drosophila_2:1640424_at:242:471; Interrogation_Position=195; Antisense; GTTCCTATCTATCGCTTATTTTGTG
>probe:Drosophila_2:1640424_at:489:107; Interrogation_Position=241; Antisense; AGAACGATTAGTTTCCTGCAGCCCC
>probe:Drosophila_2:1640424_at:443:303; Interrogation_Position=264; Antisense; CCGTATTCTGTACCCACTGATAACG
>probe:Drosophila_2:1640424_at:452:603; Interrogation_Position=281; Antisense; TGATAACGTGTGCTTCCGTGGCCAT
>probe:Drosophila_2:1640424_at:115:121; Interrogation_Position=344; Antisense; AGCGGTTGTTCTACAGCTGGGACAT
>probe:Drosophila_2:1640424_at:360:141; Interrogation_Position=385; Antisense; ACGGTGCGCTCCTTTGGCAGGGAAT
>probe:Drosophila_2:1640424_at:25:83; Interrogation_Position=403; Antisense; AGGGAATCGGTCCTCTGCGTCCAAA
>probe:Drosophila_2:1640424_at:458:209; Interrogation_Position=520; Antisense; AAGAAGCGCCCTATAATACCCCTAT
>probe:Drosophila_2:1640424_at:11:517; Interrogation_Position=570; Antisense; GTGTCTGCAGCACACATATCACGTG
>probe:Drosophila_2:1640424_at:202:131; Interrogation_Position=626; Antisense; ACCGGTCAGAAGAGTCCTACAGCAA

Paste this into a BLAST search page for me
TTCGCATCGAACTGGTGAACCGGCTTGAACCGGCTGCATGGAATCCAACTAGCGCAAGTTGCGTCGACTACTGCTTACTGCTGCTCATGTTCCTATCTATGTTCCTATCTATCGCTTATTTTGTGAGAACGATTAGTTTCCTGCAGCCCCCCGTATTCTGTACCCACTGATAACGTGATAACGTGTGCTTCCGTGGCCATAGCGGTTGTTCTACAGCTGGGACATACGGTGCGCTCCTTTGGCAGGGAATAGGGAATCGGTCCTCTGCGTCCAAAAAGAAGCGCCCTATAATACCCCTATGTGTCTGCAGCACACATATCACGTGACCGGTCAGAAGAGTCCTACAGCAA

Full Affymetrix probeset data:

Annotations for 1640424_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720