FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640425_at:

>probe:Drosophila_2:1640425_at:682:211; Interrogation_Position=453; Antisense; AAGACCCAAGGCAAGTAGTTCACAA
>probe:Drosophila_2:1640425_at:630:409; Interrogation_Position=500; Antisense; GACGAAGTCTCGTTGTTCCAGCAAG
>probe:Drosophila_2:1640425_at:429:429; Interrogation_Position=586; Antisense; GAGTTCGATGAATCCGCATTGGCAA
>probe:Drosophila_2:1640425_at:627:343; Interrogation_Position=601; Antisense; GCATTGGCAACTTCTGTGGGCTCCA
>probe:Drosophila_2:1640425_at:226:595; Interrogation_Position=615; Antisense; TGTGGGCTCCAATTTGCAGACTTTG
>probe:Drosophila_2:1640425_at:265:373; Interrogation_Position=682; Antisense; GAAGTTTTGGTCTCGCTGTCAGCAT
>probe:Drosophila_2:1640425_at:721:333; Interrogation_Position=696; Antisense; GCTGTCAGCATTATTCACCTTTGTG
>probe:Drosophila_2:1640425_at:264:577; Interrogation_Position=741; Antisense; GGCCATTTTACCAAGTACACCTGAT
>probe:Drosophila_2:1640425_at:213:491; Interrogation_Position=755; Antisense; GTACACCTGATACCGATGATTCCAA
>probe:Drosophila_2:1640425_at:649:409; Interrogation_Position=784; Antisense; GACGAAGTGATTCCCAATACCGATC
>probe:Drosophila_2:1640425_at:689:447; Interrogation_Position=811; Antisense; GATCCAAGTTTTTATCTCCCAAGTG
>probe:Drosophila_2:1640425_at:34:631; Interrogation_Position=827; Antisense; TCCCAAGTGCCGATTCTTTGTTCAA
>probe:Drosophila_2:1640425_at:52:303; Interrogation_Position=865; Antisense; CCGAATTCGCCATCCTTAGAGGTGA
>probe:Drosophila_2:1640425_at:384:247; Interrogation_Position=911; Antisense; AATTGCAACCAGCTGACATTGTCGA

Paste this into a BLAST search page for me
AAGACCCAAGGCAAGTAGTTCACAAGACGAAGTCTCGTTGTTCCAGCAAGGAGTTCGATGAATCCGCATTGGCAAGCATTGGCAACTTCTGTGGGCTCCATGTGGGCTCCAATTTGCAGACTTTGGAAGTTTTGGTCTCGCTGTCAGCATGCTGTCAGCATTATTCACCTTTGTGGGCCATTTTACCAAGTACACCTGATGTACACCTGATACCGATGATTCCAAGACGAAGTGATTCCCAATACCGATCGATCCAAGTTTTTATCTCCCAAGTGTCCCAAGTGCCGATTCTTTGTTCAACCGAATTCGCCATCCTTAGAGGTGAAATTGCAACCAGCTGACATTGTCGA

Full Affymetrix probeset data:

Annotations for 1640425_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720