FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640426_at:

>probe:Drosophila_2:1640426_at:585:49; Interrogation_Position=225; Antisense; ATGCCAAAAATGCACTTCCCATCGA
>probe:Drosophila_2:1640426_at:393:719; Interrogation_Position=240; Antisense; TTCCCATCGATGATACCCTGAGATC
>probe:Drosophila_2:1640426_at:635:425; Interrogation_Position=259; Antisense; GAGATCAGTAAAGTGCACCATGCTT
>probe:Drosophila_2:1640426_at:365:419; Interrogation_Position=358; Antisense; GAGCTATCCGAGTCCTGAGAGTCTG
>probe:Drosophila_2:1640426_at:263:89; Interrogation_Position=377; Antisense; AGTCTGGCAGGCCAAGTGTTTCCTT
>probe:Drosophila_2:1640426_at:356:83; Interrogation_Position=391; Antisense; AGTGTTTCCTTTGGCAAGTACCACA
>probe:Drosophila_2:1640426_at:705:333; Interrogation_Position=427; Antisense; GCTGAGTATGCTGATGTCTTCGAAA
>probe:Drosophila_2:1640426_at:148:537; Interrogation_Position=487; Antisense; GGTCGCGACGTATAATGAGCAGATA
>probe:Drosophila_2:1640426_at:27:457; Interrogation_Position=508; Antisense; GATATCCGCAAAAGTACCTTCCGTA
>probe:Drosophila_2:1640426_at:174:203; Interrogation_Position=541; Antisense; AACCAAGCTTATCGATTACCACAAT
>probe:Drosophila_2:1640426_at:561:213; Interrogation_Position=605; Antisense; AAGAGCCAGGTCACACAAGTTCAAA
>probe:Drosophila_2:1640426_at:436:195; Interrogation_Position=650; Antisense; AACGAACATGCACGCCAATTCAACG
>probe:Drosophila_2:1640426_at:191:135; Interrogation_Position=672; Antisense; ACGCACCGTTCCCATGCAAAAAGGT
>probe:Drosophila_2:1640426_at:78:159; Interrogation_Position=717; Antisense; ACACATGTGGAGTACGACTACGCAT

Paste this into a BLAST search page for me
ATGCCAAAAATGCACTTCCCATCGATTCCCATCGATGATACCCTGAGATCGAGATCAGTAAAGTGCACCATGCTTGAGCTATCCGAGTCCTGAGAGTCTGAGTCTGGCAGGCCAAGTGTTTCCTTAGTGTTTCCTTTGGCAAGTACCACAGCTGAGTATGCTGATGTCTTCGAAAGGTCGCGACGTATAATGAGCAGATAGATATCCGCAAAAGTACCTTCCGTAAACCAAGCTTATCGATTACCACAATAAGAGCCAGGTCACACAAGTTCAAAAACGAACATGCACGCCAATTCAACGACGCACCGTTCCCATGCAAAAAGGTACACATGTGGAGTACGACTACGCAT

Full Affymetrix probeset data:

Annotations for 1640426_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720