FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640427_at:

>probe:Drosophila_2:1640427_at:370:39; Interrogation_Position=1066; Antisense; ATCTGCACTGGAGACTATCCACTGC
>probe:Drosophila_2:1640427_at:70:125; Interrogation_Position=1091; Antisense; AGCGCCTGGTCGAAACTCTGATTAA
>probe:Drosophila_2:1640427_at:63:437; Interrogation_Position=1123; Antisense; GAGGATATATTTCACCCGCTCCATA
>probe:Drosophila_2:1640427_at:372:303; Interrogation_Position=1138; Antisense; CCGCTCCATACTTTCCAATTGTGAA
>probe:Drosophila_2:1640427_at:241:511; Interrogation_Position=1158; Antisense; GTGAAGCAGCGGACTCGTCGTTTAA
>probe:Drosophila_2:1640427_at:127:51; Interrogation_Position=665; Antisense; ATGCCGACTGTGTGGAGATCTGTTC
>probe:Drosophila_2:1640427_at:712:73; Interrogation_Position=697; Antisense; AGGAACATCATTGCCTTTGCGGCTG
>probe:Drosophila_2:1640427_at:117:587; Interrogation_Position=785; Antisense; TGGAGATGCTTCAGTTCGTCGATGT
>probe:Drosophila_2:1640427_at:177:337; Interrogation_Position=821; Antisense; GCTGCCGCATGGGAACCTTTTTTGA
>probe:Drosophila_2:1640427_at:698:355; Interrogation_Position=833; Antisense; GAACCTTTTTTGAGTCCTGCGGAAT
>probe:Drosophila_2:1640427_at:102:175; Interrogation_Position=885; Antisense; AAACCGCAATCGCAAGTTGGCCGAA
>probe:Drosophila_2:1640427_at:56:407; Interrogation_Position=921; Antisense; GACGGGCAAACCCTTGAGCGAACTG
>probe:Drosophila_2:1640427_at:39:113; Interrogation_Position=947; Antisense; AGCACATTCTCATTCCAGGACACGA
>probe:Drosophila_2:1640427_at:18:157; Interrogation_Position=988; Antisense; ACAGCGGAGCTGGTGCATCATATGC

Paste this into a BLAST search page for me
ATCTGCACTGGAGACTATCCACTGCAGCGCCTGGTCGAAACTCTGATTAAGAGGATATATTTCACCCGCTCCATACCGCTCCATACTTTCCAATTGTGAAGTGAAGCAGCGGACTCGTCGTTTAAATGCCGACTGTGTGGAGATCTGTTCAGGAACATCATTGCCTTTGCGGCTGTGGAGATGCTTCAGTTCGTCGATGTGCTGCCGCATGGGAACCTTTTTTGAGAACCTTTTTTGAGTCCTGCGGAATAAACCGCAATCGCAAGTTGGCCGAAGACGGGCAAACCCTTGAGCGAACTGAGCACATTCTCATTCCAGGACACGAACAGCGGAGCTGGTGCATCATATGC

Full Affymetrix probeset data:

Annotations for 1640427_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720