Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640431_at:

>probe:Drosophila_2:1640431_at:335:293; Interrogation_Position=1568; Antisense; CGTTGACTATCAGCCGAATCTCATC
>probe:Drosophila_2:1640431_at:689:365; Interrogation_Position=1583; Antisense; GAATCTCATCAACGATCCAAGTCTG
>probe:Drosophila_2:1640431_at:342:643; Interrogation_Position=1636; Antisense; TCTCCCTGGACTTTTCGACAGATAC
>probe:Drosophila_2:1640431_at:379:405; Interrogation_Position=1666; Antisense; GACTCGATAATCTGCTGGACACTTC
>probe:Drosophila_2:1640431_at:234:623; Interrogation_Position=1678; Antisense; TGCTGGACACTTCGCAACAGGACAA
>probe:Drosophila_2:1640431_at:644:207; Interrogation_Position=1713; Antisense; AAGCTGCTGCCGGACTATGAAATGT
>probe:Drosophila_2:1640431_at:700:611; Interrogation_Position=1730; Antisense; TGAAATGTTCGCTCCGGAAGCAGAA
>probe:Drosophila_2:1640431_at:345:381; Interrogation_Position=1752; Antisense; GAACCCCATAAGAAGCGAGCAGCCA
>probe:Drosophila_2:1640431_at:429:325; Interrogation_Position=1794; Antisense; GCGAGCGGTCCCAAAATGGCCAAGA
>probe:Drosophila_2:1640431_at:597:607; Interrogation_Position=1871; Antisense; TGAGGCTCTGACGAGTTGCACGGCC
>probe:Drosophila_2:1640431_at:322:577; Interrogation_Position=1892; Antisense; GGCCGCCCAGTTGCATTTTATTCTG
>probe:Drosophila_2:1640431_at:34:715; Interrogation_Position=1912; Antisense; TTCTGCAGCATCACTTCGATGTTAC
>probe:Drosophila_2:1640431_at:121:475; Interrogation_Position=1932; Antisense; GTTACAATGCCCAAGTCGTCAAAGA
>probe:Drosophila_2:1640431_at:309:165; Interrogation_Position=2024; Antisense; AAATCTGTACCAATCTAGCTTGTAT

Paste this into a BLAST search page for me
CGTTGACTATCAGCCGAATCTCATCGAATCTCATCAACGATCCAAGTCTGTCTCCCTGGACTTTTCGACAGATACGACTCGATAATCTGCTGGACACTTCTGCTGGACACTTCGCAACAGGACAAAAGCTGCTGCCGGACTATGAAATGTTGAAATGTTCGCTCCGGAAGCAGAAGAACCCCATAAGAAGCGAGCAGCCAGCGAGCGGTCCCAAAATGGCCAAGATGAGGCTCTGACGAGTTGCACGGCCGGCCGCCCAGTTGCATTTTATTCTGTTCTGCAGCATCACTTCGATGTTACGTTACAATGCCCAAGTCGTCAAAGAAAATCTGTACCAATCTAGCTTGTAT

Full Affymetrix probeset data:

Annotations for 1640431_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime