FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640432_at:

>probe:Drosophila_2:1640432_at:382:495; Interrogation_Position=109; Antisense; GTCAGCCACAATAACGCCGATCAAT
>probe:Drosophila_2:1640432_at:397:49; Interrogation_Position=13; Antisense; ATGCCAATTTCATTTCTCAACTCGC
>probe:Drosophila_2:1640432_at:597:373; Interrogation_Position=209; Antisense; GAAGTCACCATATGCCACGAGGCGA
>probe:Drosophila_2:1640432_at:540:447; Interrogation_Position=238; Antisense; GATGCCGCCGGTGAGTCAGATCCAA
>probe:Drosophila_2:1640432_at:198:513; Interrogation_Position=248; Antisense; GTGAGTCAGATCCAAACCTTCGAAT
>probe:Drosophila_2:1640432_at:446:197; Interrogation_Position=262; Antisense; AACCTTCGAATAGCCGAGCGCAGGA
>probe:Drosophila_2:1640432_at:185:217; Interrogation_Position=286; Antisense; AAGGGCCGTGTTCCTCGCAATAGGA
>probe:Drosophila_2:1640432_at:269:195; Interrogation_Position=304; Antisense; AATAGGAGTCTTCAAGGGCAACCTC
>probe:Drosophila_2:1640432_at:436:399; Interrogation_Position=327; Antisense; TCCCTTGACTCCAGTAGTTTCCATG
>probe:Drosophila_2:1640432_at:538:677; Interrogation_Position=341; Antisense; TAGTTTCCATGGACAGGCGTCGAAC
>probe:Drosophila_2:1640432_at:507:289; Interrogation_Position=358; Antisense; CGTCGAACGCCACGATTGTTTTCAA
>probe:Drosophila_2:1640432_at:190:465; Interrogation_Position=371; Antisense; GATTGTTTTCAACGGCCGTCAACCG
>probe:Drosophila_2:1640432_at:637:201; Interrogation_Position=48; Antisense; AACCACAACCACTTTAGTACCAGCT
>probe:Drosophila_2:1640432_at:656:25; Interrogation_Position=86; Antisense; ATAGCATCACCAACGACAACCAAGT

Paste this into a BLAST search page for me
GTCAGCCACAATAACGCCGATCAATATGCCAATTTCATTTCTCAACTCGCGAAGTCACCATATGCCACGAGGCGAGATGCCGCCGGTGAGTCAGATCCAAGTGAGTCAGATCCAAACCTTCGAATAACCTTCGAATAGCCGAGCGCAGGAAAGGGCCGTGTTCCTCGCAATAGGAAATAGGAGTCTTCAAGGGCAACCTCTCCCTTGACTCCAGTAGTTTCCATGTAGTTTCCATGGACAGGCGTCGAACCGTCGAACGCCACGATTGTTTTCAAGATTGTTTTCAACGGCCGTCAACCGAACCACAACCACTTTAGTACCAGCTATAGCATCACCAACGACAACCAAGT

Full Affymetrix probeset data:

Annotations for 1640432_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720