Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640434_at:

>probe:Drosophila_2:1640434_at:80:123; Interrogation_Position=1033; Antisense; AGCGCCCCGGAATTACGATTGAGTT
>probe:Drosophila_2:1640434_at:406:465; Interrogation_Position=1049; Antisense; GATTGAGTTCTATCCAGCTGAAGCA
>probe:Drosophila_2:1640434_at:623:245; Interrogation_Position=1082; Antisense; AATTCATTCTCTGTCATAGCACCTA
>probe:Drosophila_2:1640434_at:692:455; Interrogation_Position=593; Antisense; GATACATGTCTCCAGAAGCTCTGCG
>probe:Drosophila_2:1640434_at:50:379; Interrogation_Position=607; Antisense; GAAGCTCTGCGATCGGATACCCTTA
>probe:Drosophila_2:1640434_at:601:631; Interrogation_Position=640; Antisense; TCCGATATTTACTCCCTGGGCATTA
>probe:Drosophila_2:1640434_at:404:595; Interrogation_Position=668; Antisense; TGTGGCAACTGCAAGCGCGTAGATT
>probe:Drosophila_2:1640434_at:411:591; Interrogation_Position=737; Antisense; TGGTCAAGCACGAACTGCGTCCGGA
>probe:Drosophila_2:1640434_at:413:329; Interrogation_Position=753; Antisense; GCGTCCGGACAACTATCATCAACTA
>probe:Drosophila_2:1640434_at:237:133; Interrogation_Position=835; Antisense; ACCGCCAACGTGATCTGCAGAAGGG
>probe:Drosophila_2:1640434_at:699:493; Interrogation_Position=878; Antisense; GTAATCTAAGCCTCGATCCATCTTA
>probe:Drosophila_2:1640434_at:162:131; Interrogation_Position=904; Antisense; ACCGTCGGCCGTGATCTGAAAAAGA
>probe:Drosophila_2:1640434_at:396:703; Interrogation_Position=946; Antisense; TTAGCACTCCACTTTGATAGTCCGG
>probe:Drosophila_2:1640434_at:304:173; Interrogation_Position=995; Antisense; AAAGCGCTTACTCCCAATTATACAA

Paste this into a BLAST search page for me
AGCGCCCCGGAATTACGATTGAGTTGATTGAGTTCTATCCAGCTGAAGCAAATTCATTCTCTGTCATAGCACCTAGATACATGTCTCCAGAAGCTCTGCGGAAGCTCTGCGATCGGATACCCTTATCCGATATTTACTCCCTGGGCATTATGTGGCAACTGCAAGCGCGTAGATTTGGTCAAGCACGAACTGCGTCCGGAGCGTCCGGACAACTATCATCAACTAACCGCCAACGTGATCTGCAGAAGGGGTAATCTAAGCCTCGATCCATCTTAACCGTCGGCCGTGATCTGAAAAAGATTAGCACTCCACTTTGATAGTCCGGAAAGCGCTTACTCCCAATTATACAA

Full Affymetrix probeset data:

Annotations for 1640434_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime