FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640435_at:

>probe:Drosophila_2:1640435_at:170:91; Interrogation_Position=1008; Antisense; AGTAGAACTGTTACGCTGTGCAAGA
>probe:Drosophila_2:1640435_at:357:97; Interrogation_Position=579; Antisense; AGATCAGCTCCGAGGATGACGCCGA
>probe:Drosophila_2:1640435_at:673:55; Interrogation_Position=594; Antisense; ATGACGCCGACTCCGTGGACAACAT
>probe:Drosophila_2:1640435_at:475:157; Interrogation_Position=626; Antisense; ACAAGAAACAAAGTGGCGCCGGGTG
>probe:Drosophila_2:1640435_at:472:585; Interrogation_Position=676; Antisense; TGGAACGTCTGTCTCGGCAGCAGCA
>probe:Drosophila_2:1640435_at:588:349; Interrogation_Position=704; Antisense; GCAGAAGCGGAATCAGTTCGAGAAT
>probe:Drosophila_2:1640435_at:93:113; Interrogation_Position=755; Antisense; AGCAGAAAGCCGGTAGCCCCGAGTC
>probe:Drosophila_2:1640435_at:68:433; Interrogation_Position=775; Antisense; GAGTCCTGTTCGAAGTCATAGCCAA
>probe:Drosophila_2:1640435_at:213:255; Interrogation_Position=797; Antisense; CAACATCCAATCTAATCCAATCCTA
>probe:Drosophila_2:1640435_at:335:149; Interrogation_Position=823; Antisense; ACATTTATCCGGCATCCACAAAGCG
>probe:Drosophila_2:1640435_at:465:257; Interrogation_Position=839; Antisense; CACAAAGCGGCGCAGCGGCAGTTAA
>probe:Drosophila_2:1640435_at:293:321; Interrogation_Position=867; Antisense; GCGAAACCAAACCTATAGTATCAGT
>probe:Drosophila_2:1640435_at:473:483; Interrogation_Position=884; Antisense; GTATCAGTTCATTTATAGCCATTTT
>probe:Drosophila_2:1640435_at:515:703; Interrogation_Position=970; Antisense; TTATGGCCGCCTTAAACAACAAATT

Paste this into a BLAST search page for me
AGTAGAACTGTTACGCTGTGCAAGAAGATCAGCTCCGAGGATGACGCCGAATGACGCCGACTCCGTGGACAACATACAAGAAACAAAGTGGCGCCGGGTGTGGAACGTCTGTCTCGGCAGCAGCAGCAGAAGCGGAATCAGTTCGAGAATAGCAGAAAGCCGGTAGCCCCGAGTCGAGTCCTGTTCGAAGTCATAGCCAACAACATCCAATCTAATCCAATCCTAACATTTATCCGGCATCCACAAAGCGCACAAAGCGGCGCAGCGGCAGTTAAGCGAAACCAAACCTATAGTATCAGTGTATCAGTTCATTTATAGCCATTTTTTATGGCCGCCTTAAACAACAAATT

Full Affymetrix probeset data:

Annotations for 1640435_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720