Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640436_at:

>probe:Drosophila_2:1640436_at:297:557; Interrogation_Position=1476; Antisense; GGACATATACTACGTGCTGACCGAC
>probe:Drosophila_2:1640436_at:668:619; Interrogation_Position=1490; Antisense; TGCTGACCGACGAGGGTACCCTGTA
>probe:Drosophila_2:1640436_at:457:673; Interrogation_Position=1531; Antisense; TACCCGCTGCAGCACTTGGAACTAA
>probe:Drosophila_2:1640436_at:320:657; Interrogation_Position=1553; Antisense; TAAGGCAGGTGCACGATGGACCCGC
>probe:Drosophila_2:1640436_at:577:223; Interrogation_Position=1608; Antisense; AAGGATGTACCTCACTTGCGGCAGC
>probe:Drosophila_2:1640436_at:33:623; Interrogation_Position=1624; Antisense; TGCGGCAGCGACTGGTGCATTCGTA
>probe:Drosophila_2:1640436_at:528:619; Interrogation_Position=1639; Antisense; TGCATTCGTATCTGGCTGGCTGGAA
>probe:Drosophila_2:1640436_at:210:333; Interrogation_Position=1657; Antisense; GCTGGAATCCTGTTGCCCATCGTGA
>probe:Drosophila_2:1640436_at:86:587; Interrogation_Position=1769; Antisense; TGGACATCTGGGACCTGCGCAATAG
>probe:Drosophila_2:1640436_at:526:195; Interrogation_Position=1801; Antisense; AAGCCGGTGTCCTCCACGGTGATAG
>probe:Drosophila_2:1640436_at:626:513; Interrogation_Position=1819; Antisense; GTGATAGACGCCGACATCTTCTACA
>probe:Drosophila_2:1640436_at:414:319; Interrogation_Position=1938; Antisense; GCCGCACTTTCAGTACAAGCAGCTG
>probe:Drosophila_2:1640436_at:361:213; Interrogation_Position=1963; Antisense; AAGAGAGCCATCTTCAAGGCCCTCT
>probe:Drosophila_2:1640436_at:307:213; Interrogation_Position=2017; Antisense; AAGAGCGTCGGCTACTTTGGCTATC

Paste this into a BLAST search page for me
GGACATATACTACGTGCTGACCGACTGCTGACCGACGAGGGTACCCTGTATACCCGCTGCAGCACTTGGAACTAATAAGGCAGGTGCACGATGGACCCGCAAGGATGTACCTCACTTGCGGCAGCTGCGGCAGCGACTGGTGCATTCGTATGCATTCGTATCTGGCTGGCTGGAAGCTGGAATCCTGTTGCCCATCGTGATGGACATCTGGGACCTGCGCAATAGAAGCCGGTGTCCTCCACGGTGATAGGTGATAGACGCCGACATCTTCTACAGCCGCACTTTCAGTACAAGCAGCTGAAGAGAGCCATCTTCAAGGCCCTCTAAGAGCGTCGGCTACTTTGGCTATC

Full Affymetrix probeset data:

Annotations for 1640436_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime