FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640437_at:

>probe:Drosophila_2:1640437_at:547:51; Interrogation_Position=1042; Antisense; ATGCGATCGAGTTTGGGATGTCCCA
>probe:Drosophila_2:1640437_at:727:545; Interrogation_Position=1057; Antisense; GGATGTCCCATCGATGGTTACTTCT
>probe:Drosophila_2:1640437_at:451:271; Interrogation_Position=1073; Antisense; GTTACTTCTTCGAGGCCAATCGGGA
>probe:Drosophila_2:1640437_at:330:425; Interrogation_Position=1096; Antisense; GAGACGCTCATCACGATTGTGCGCA
>probe:Drosophila_2:1640437_at:454:507; Interrogation_Position=1114; Antisense; GTGCGCACTGCTATATCCTATGTAA
>probe:Drosophila_2:1640437_at:726:679; Interrogation_Position=1132; Antisense; TATGTAACGCTACTCAGATCCCTGG
>probe:Drosophila_2:1640437_at:248:585; Interrogation_Position=602; Antisense; TGGACACACTGTTCTGTTCTCTGAG
>probe:Drosophila_2:1640437_at:714:609; Interrogation_Position=623; Antisense; TGAGCCATAATCTCTGTGCCCTATT
>probe:Drosophila_2:1640437_at:297:51; Interrogation_Position=734; Antisense; ATGCGTTGTGTTTGAACCTGGGCCA
>probe:Drosophila_2:1640437_at:344:103; Interrogation_Position=778; Antisense; AGACCGCTCATCTGCCAGTTTGTGG
>probe:Drosophila_2:1640437_at:432:597; Interrogation_Position=827; Antisense; TGTGCTACCAACTGTCTGCCAATAT
>probe:Drosophila_2:1640437_at:647:79; Interrogation_Position=905; Antisense; AGGTGTCTATATACTGCTTCTGCGG
>probe:Drosophila_2:1640437_at:227:451; Interrogation_Position=929; Antisense; GATCGAGCATCCATTCGGAGTGTCA
>probe:Drosophila_2:1640437_at:627:433; Interrogation_Position=946; Antisense; GAGTGTCAGCTATTTGGCCAGGCCA

Paste this into a BLAST search page for me
ATGCGATCGAGTTTGGGATGTCCCAGGATGTCCCATCGATGGTTACTTCTGTTACTTCTTCGAGGCCAATCGGGAGAGACGCTCATCACGATTGTGCGCAGTGCGCACTGCTATATCCTATGTAATATGTAACGCTACTCAGATCCCTGGTGGACACACTGTTCTGTTCTCTGAGTGAGCCATAATCTCTGTGCCCTATTATGCGTTGTGTTTGAACCTGGGCCAAGACCGCTCATCTGCCAGTTTGTGGTGTGCTACCAACTGTCTGCCAATATAGGTGTCTATATACTGCTTCTGCGGGATCGAGCATCCATTCGGAGTGTCAGAGTGTCAGCTATTTGGCCAGGCCA

Full Affymetrix probeset data:

Annotations for 1640437_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720