FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640438_at:

>probe:Drosophila_2:1640438_at:35:287; Interrogation_Position=1006; Antisense; CTGGAGTACTTTGTGCCGCGTAGCA
>probe:Drosophila_2:1640438_at:270:319; Interrogation_Position=1020; Antisense; GCCGCGTAGCATCAGTGAGTTCAAT
>probe:Drosophila_2:1640438_at:336:249; Interrogation_Position=1041; Antisense; CAATCTGTCGGGAGTGGGCGATCTC
>probe:Drosophila_2:1640438_at:546:257; Interrogation_Position=1079; Antisense; CACGTCGATACTCACCCAATATGGT
>probe:Drosophila_2:1640438_at:124:595; Interrogation_Position=1169; Antisense; TGGGCATGGGTCTGCCACATGGCCT
>probe:Drosophila_2:1640438_at:214:95; Interrogation_Position=1196; Antisense; AGTTGGGTCCACCACAGACGCTGCT
>probe:Drosophila_2:1640438_at:560:357; Interrogation_Position=1273; Antisense; GCACAACTGCAGATTGTCACCCTAA
>probe:Drosophila_2:1640438_at:481:533; Interrogation_Position=1411; Antisense; GGTGTGCCGACGACTCCGCGAAAAT
>probe:Drosophila_2:1640438_at:655:309; Interrogation_Position=1438; Antisense; CCAGCCGTGGGCGATATATTCATGT
>probe:Drosophila_2:1640438_at:3:157; Interrogation_Position=878; Antisense; ACACGCTGACGCAGTACAGTTCGCT
>probe:Drosophila_2:1640438_at:348:89; Interrogation_Position=890; Antisense; AGTACAGTTCGCTGCCGCGCAGGAG
>probe:Drosophila_2:1640438_at:128:565; Interrogation_Position=962; Antisense; GGAATACGCCCATCCGCAGATCGAC
>probe:Drosophila_2:1640438_at:392:95; Interrogation_Position=979; Antisense; AGATCGACGGGCATACCGGAGCATC
>probe:Drosophila_2:1640438_at:497:131; Interrogation_Position=993; Antisense; ACCGGAGCATCATCTGGAGTACTTT

Paste this into a BLAST search page for me
CTGGAGTACTTTGTGCCGCGTAGCAGCCGCGTAGCATCAGTGAGTTCAATCAATCTGTCGGGAGTGGGCGATCTCCACGTCGATACTCACCCAATATGGTTGGGCATGGGTCTGCCACATGGCCTAGTTGGGTCCACCACAGACGCTGCTGCACAACTGCAGATTGTCACCCTAAGGTGTGCCGACGACTCCGCGAAAATCCAGCCGTGGGCGATATATTCATGTACACGCTGACGCAGTACAGTTCGCTAGTACAGTTCGCTGCCGCGCAGGAGGGAATACGCCCATCCGCAGATCGACAGATCGACGGGCATACCGGAGCATCACCGGAGCATCATCTGGAGTACTTT

Full Affymetrix probeset data:

Annotations for 1640438_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720