FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640439_at:

>probe:Drosophila_2:1640439_at:205:631; Interrogation_Position=104; Antisense; TCCTCATTGCGCGAGATTGCTGTTG
>probe:Drosophila_2:1640439_at:720:7; Interrogation_Position=119; Antisense; ATTGCTGTTGCACCGGTTTTCATTA
>probe:Drosophila_2:1640439_at:13:477; Interrogation_Position=134; Antisense; GTTTTCATTACCATGGCGGCTCAGG
>probe:Drosophila_2:1640439_at:457:571; Interrogation_Position=151; Antisense; GGCTCAGGTCACACCAAAGATCTCT
>probe:Drosophila_2:1640439_at:17:97; Interrogation_Position=168; Antisense; AGATCTCTACATGCATTAACTCGAA
>probe:Drosophila_2:1640439_at:130:231; Interrogation_Position=254; Antisense; AATGAATCAACGCTACCACTATCCG
>probe:Drosophila_2:1640439_at:563:449; Interrogation_Position=281; Antisense; GATCCGAGGACACTGCAATTGGCAT
>probe:Drosophila_2:1640439_at:527:651; Interrogation_Position=337; Antisense; TCAAAATTGCTATGCGCAGCCTGCT
>probe:Drosophila_2:1640439_at:513:671; Interrogation_Position=369; Antisense; TACCAATGCCCCTAAGTGCACGAAG
>probe:Drosophila_2:1640439_at:655:163; Interrogation_Position=402; Antisense; AAATAGGGACCATCAACAGCACGCT
>probe:Drosophila_2:1640439_at:543:143; Interrogation_Position=447; Antisense; ACTGTCTTCTATTACCGAATGCCGG
>probe:Drosophila_2:1640439_at:407:577; Interrogation_Position=470; Antisense; GGCGCCGTCAGTTCAGAAGATCGAT
>probe:Drosophila_2:1640439_at:118:101; Interrogation_Position=51; Antisense; AGAGTTCCATATCATCCGTCAATTT
>probe:Drosophila_2:1640439_at:443:675; Interrogation_Position=511; Antisense; TATGACCGAATGTGTTCCAGTCCCC

Paste this into a BLAST search page for me
TCCTCATTGCGCGAGATTGCTGTTGATTGCTGTTGCACCGGTTTTCATTAGTTTTCATTACCATGGCGGCTCAGGGGCTCAGGTCACACCAAAGATCTCTAGATCTCTACATGCATTAACTCGAAAATGAATCAACGCTACCACTATCCGGATCCGAGGACACTGCAATTGGCATTCAAAATTGCTATGCGCAGCCTGCTTACCAATGCCCCTAAGTGCACGAAGAAATAGGGACCATCAACAGCACGCTACTGTCTTCTATTACCGAATGCCGGGGCGCCGTCAGTTCAGAAGATCGATAGAGTTCCATATCATCCGTCAATTTTATGACCGAATGTGTTCCAGTCCCC

Full Affymetrix probeset data:

Annotations for 1640439_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720