FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640440_at:

>probe:Drosophila_2:1640440_at:332:185; Interrogation_Position=337; Antisense; AACAACGAGGCATCCGCTTTGGTGG
>probe:Drosophila_2:1640440_at:424:729; Interrogation_Position=355; Antisense; TTGGTGGCCAACTCTGATGACCTGT
>probe:Drosophila_2:1640440_at:385:325; Interrogation_Position=396; Antisense; GCGAACGGATGTCGATCACGTCTTC
>probe:Drosophila_2:1640440_at:470:625; Interrogation_Position=411; Antisense; TCACGTCTTCCTGCGTTTCGGAAAA
>probe:Drosophila_2:1640440_at:33:225; Interrogation_Position=459; Antisense; AAGGACATCCCGAACACCACTTGGT
>probe:Drosophila_2:1640440_at:443:55; Interrogation_Position=490; Antisense; ATGAGACAACGACACTGGACCCTGA
>probe:Drosophila_2:1640440_at:329:555; Interrogation_Position=506; Antisense; GGACCCTGACCACAAGCGGCGGAAT
>probe:Drosophila_2:1640440_at:83:367; Interrogation_Position=527; Antisense; GAATCGTTTCTGTTCACCCAAAAAG
>probe:Drosophila_2:1640440_at:547:187; Interrogation_Position=555; Antisense; AACACTATTTTGACGTCTTCAGCAT
>probe:Drosophila_2:1640440_at:728:145; Interrogation_Position=617; Antisense; ACTCAATTGGAAGCTCTCTAGTTCA
>probe:Drosophila_2:1640440_at:385:49; Interrogation_Position=648; Antisense; ATCCAATGTCCAATGTTTCTATGCA
>probe:Drosophila_2:1640440_at:501:211; Interrogation_Position=710; Antisense; AAGACCCTCGAAATGTTCTGAAAGT
>probe:Drosophila_2:1640440_at:695:697; Interrogation_Position=753; Antisense; TTAATTCGTACTCTTTATTTGCTGA
>probe:Drosophila_2:1640440_at:195:39; Interrogation_Position=822; Antisense; ATCTCACACATATTTCCCTAGCATG

Paste this into a BLAST search page for me
AACAACGAGGCATCCGCTTTGGTGGTTGGTGGCCAACTCTGATGACCTGTGCGAACGGATGTCGATCACGTCTTCTCACGTCTTCCTGCGTTTCGGAAAAAAGGACATCCCGAACACCACTTGGTATGAGACAACGACACTGGACCCTGAGGACCCTGACCACAAGCGGCGGAATGAATCGTTTCTGTTCACCCAAAAAGAACACTATTTTGACGTCTTCAGCATACTCAATTGGAAGCTCTCTAGTTCAATCCAATGTCCAATGTTTCTATGCAAAGACCCTCGAAATGTTCTGAAAGTTTAATTCGTACTCTTTATTTGCTGAATCTCACACATATTTCCCTAGCATG

Full Affymetrix probeset data:

Annotations for 1640440_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720